Skip to main content

CRISPR/Cas9-induced β-carotene hydroxylase mutation in Dunaliella salina CCAP19/18


Dunaliella salina (D. salina) has been exploited as a novel expression system for the field of genetic engineering. However, owing to the low or inconsistent expression of target proteins, it has been greatly restricted to practical production of recombinant proteins. Since the accurate gene editing function of clustered regularly interspaced short palindromic repeat (CRISPR)/Cas system, β-carotene hydroxylase gene was chosen as an example to explore D. salina application with the purpose of improving expression level of foreign genes. In this paper, based on pKSE401 backbone, three CRISPR/Cas9 binary vectors were constructed to targeting exon 1 and 3 of the β-carotene hydroxylase of D. salina CCAP19/18 (Dschyb). D. salina mutants were obtained by salt gradient transformation method, and the expression of Dschyb gene were identified through real-time fluorescent quantitative PCR. Moreover, carotenoids content was analyzed by high-performance liquid chromatography at different time points after high intensity treatment. Compared with wild type strains, the β-carotene levels of mutants showed a significant increase, nearly up to 1.4 μg/ml, and the levels of zeaxanthin decreased to various degrees in mutants. All the results provide a compelling evidence for targeted gene editing in D. salina. This study gave a first successful gene editing of D. salina which has a very important practical significance for increasing carotene yield and meeting realistic industry demand. Furthermore, it provides an approach to overcome the current obstacles of D. salina, and then gives a strong tool to facilitates the development and application of D. salina system.


Presently, Dunaliella salina (D. salina) is the best commercial source of natural β-carotene. According to the optimized condition, β-carotene could accumulate up to 32.0 mg/L (Xi et al. 2020). And now, D. salina has been used as a huge commercial sources of carotenoids, such as phytoene, phytofluene, lutein, and zeaxanthin (Xu et al. 2018; Saha et al. 2018; Liang et al. 2019). Not only that, the raising market demand for natural pigments increased the efforts to enhance production of carotenoids from biological sources. Although several studies have addressed the effect of different culture conditions on β-carotene content in D. salina, its accumulation leads to reduced growth rates, including extreme temperatures, high salinity, and nitrogen limitation (Xu and Harvey 2019). So, molecular approaches have shown great potentials to enhance the accumulation of bio-products, such as metabolic engineering, transcriptional engineering, and gene disruption strategies (Wichuk et al. 2014; Zhang et al. 2018).

The clustered regularly interspaced short palindromic repeat (CRISPR) technology is a versatile tool to perform genome editing in different organisms ranging from prokaryote to eucaryote. And now, CRISPR/Cas system has been used as an enormously powerful tool in the drug discovery, disease treatment, pollution control, and other fields (Fellmann et al. 2017; Khadempar et al. 2019; Feng et al. 2020). Thus, this system offers an excellent integration point for development of D. salina bioreactor. Competent CRISPR-based genome editing techniques have been reported in several microalgal species, such as enhancing of lipid content, and improving of biomass production (Liang et al. 2019). Compare with the traditional transgenic methods, CRISPR/Cas system has advantages of easy design, high-efficiency, and capability of multiplex genome editing (Sternberg et al. 2014).

β-Carotene hydroxylase is a key enzyme in the pathway of carotenoid biosynthesis in plants, which catalyse the conversion of β-carotene to zeaxanthin for carotenoid biosynthetic pathway (Lamers et al. 2008). In theory, blocking or silencing this enzyme can increase the content of β-carotene in D. salina cells. For instance, RNA interference technology has been used to silence β-carotene hydroxylase of maize endosperm and potatoes, which successfully increased the carotene content (Berman et al. 2017; Kim et al. 2012). To test our hypothesis, we attempted to knockout β-carotene hydroxylase of D. salina (Dschyb) gene with CRISPR/Cas9 system. The results demonstrated that the specific-mutants of Dschyb have been successfully created by CRISPR technology. This is the first report of gene editing in D. salina with the CRISPR/Cas system. It not only can facilitate the development and application of D. salina system, but also give a strong tool to overcome the current obstacles of D. salina.

Materials and methods

Algal strain and culture conditions

D. salina CCAP19/18 D Kessler were purchased from the Guangyu Biotech Co., Ltd (Wenzhou, China), and cultured in the modified PKS medium, which comprising 1.5 M NaCl, 10 mM KNO3, 50 mM NaHCO3, 5 mM MgSO4.7H2O, 0.4 mM KH2PO4, 2 μM FeCl3∙6H2O, 5 μM EDTA, 7 μM MnCl2∙4H2O, 1 μM CuCl2∙2H2O, 1 μM ZnCl2, 1 μM CoCl2∙6H2O, 1 μM (NH4) Mo7O24.4H2O, 185 μM H3Bo3, 0.2 mM CaCl2, at 26℃ with a 12 h-light/day under light intensity of 4000 Lux. The pKSE401 vector was a gift from Professor Gongyao Shi of Zhengzhou University. In previous studies, pKSE401 vector has been successfully applied into Arabidopsis (Xing et al. 2014) and Brassica napus (B. napus) (Yang et al. 2017) to generate mutants with a high efficiency. zCAS9-NLS was under control of two constitutive 35S promoters, and the sgRNA scaffolds expression was driven by Arabidopsis U6-26 promoter.

Vector construction and D. salina transformation

We manually search for 23 bp target sites (5'-N 20 NGG-3') within exons of genomic DNA sequences of Dschyb (GenBank: KX096216.1) on the website of Based on the optimization principles (Nymark et al. 2016), three single guide RNA (sgRNA) sequences were designed to introduce two Bsa I flanking sites and named in sgRNA1-F, sgRNA2-F and sgRNA3-F, respectively (Table 1). Golden gate cloning was used to assemble sgRNA, which allows to obtain nearly one hundred percent correct recombinant plasmids (Vecchione et al. 2019). For assembly of sgRNA, equal volumes of 100 μM oligos 1 and 2 were mixed and then incubated at 80℃ for 10 min. After that, the mixture was cooled slowly to room temperature, resulting in a double-stranded insert with 4-nt 5′ overhangs at both ends. Annealed double-stranded oligonucleotides together with pKSE401 was used to set up restriction-ligation reactions using Bsa I and T4 ligase (NEB, Ipswich, USA). The reaction was incubated orderly in a thermocycler for 2 h at 37℃, 5 min at 50℃ and 10 min at 80℃. Consequently, the constructed plasmids were named as pKSE401-sgRNA1, pKSE401-sgRNA2 and pKSE401-sgRNA3, which correspond to the regions in exon 3 and 1 of Dschyb, respectively (Fig. 1). Using these constructed plasmids, D. salina cells were transformed separately with salt gradients method (Feng et al. 2020). After 2–3 days transformation, cells were cultured in fresh medium with 700 µg/mL G418 in a 12-well plate at 26℃ light incubator. And then, transformed cells were plated on the solid antibiotic-free medium (0.8% agarose, w/v) to obtain single colonies. During 10 days culture, culture dishes were inverted and placed in an illuminated incubator with 12 h light / 12 h dark (26 °C) photo-period. Finally, the positive colonies were detected by polymerase chain reaction (PCR) amplification and gene sequencing.

Table 1 The primers used for different vectors construction
Fig. 1
figure 1

Schematic diagram of three sgRNA targeting sites for Dschyb locus. Blue module represents exon; Orange line represents intron; Orange marked sequence is PAM site

PCR identification of mutants

The single algae colonies were picked with a 10 µL inoculation loops and re-suspended in fresh medium. Another portion of the same single colony was directly used for single algae colony PCR with the Phire Plant Direct PCR Master Mix kit (Thermo Fisher Scientific, Shanghai, China). Briefly, a 0.5 mm single algae colony was picked from the agar plate using a pipette. The samples were placed directly into 50 µL PCR reactions. Reactions were run following the cycling conditions: 5 min at 98 ℃, then 35 cycles of 5 s at 98 ℃, 5 s at 58.4 ℃, 40 s at 72 ℃, and a final extension of 1 min at 72 ℃. The PCR products were analyzed by 1% agarose gel electrophoresis. Next, Mutants were screened by analyzing the size of PCR products. Sanger sequencing reactions of PCR products were carried out by Sangon Biotech Co., Ltd (Shanghai, China). Finally, DNA sequences were analyzed with the snapgene software.

sgRNA transcription in vitro and cleavage assay

Using pKSE401 as the template, forwards primers were designed for adding the T7 promoter sequence (TTAATACGACTCACTATAGG) into sgRNA loop by PCR. T7 sgRNA-R-common was used as the reverse primer to obtain the final DNA fragment for transcription in vitro. PCR was carried out using 2X high fidelity PCR master mix (Sangon, Shanghai, China) as follows: initial denaturation at 95 ℃ for 30 s, 35 cycles of 95 ℃ for 15 s, 58 ℃ for 15 s and 72 ℃ for 20 s, a final extension at 72 ℃ for 5 min, and termination at 4 ℃. The T7-sgRNA primer sequence are summarized in Table 2, which named T7-sgRNA-F1, T7-sgRNA-F2, and T7-sgRNA-F3, respectively. The corresponding DNA were transcribed in vitro with the HiScribe T7 high yield RNA synthesis kit (NEB, Ipswich, USA). Next, sgRNAs (T7-sgRNA1, T7-sgRNA2 and T7-sgRNA3) for targeting Dschyb were produced with the transcriptions in vitro.

Table 2 The primers used for sgRNA transcription in vitro and target genes

Before cleavage assay, total RNAs were purified using Trizol (Cwbio, Taizhou, China) and finally dissolved in RNase free water. Purified RNA was quantified by spectrometry for further use. To obtain the RNP complex harbouring pre-assembled Cas effector protein and the targeting sgRNA, equimolar amount of Cas protein (YSY, NanJing, China) and sgRNA were incubated in a sterile 1.5 mL eppendorf tube at 37 ℃ for 15 min along with 3 µL 10X Cas buffer and milliQ water to a final volume of 30 µL. After 15 min incubation, 400 ng of target DNA was added into the reaction mixture and incubated again for 1 h. And then, Cas9 nuclease was inactivated at 65 °C for 10 min. The target DNA was amplified from the host genomic DNA with the high fidelity PCR master mix (Sangon, Shanghai, China) using primers CHY-F and CHY-R (Table 2). After that, PCR fragments were analyzed by 1% agarose gel electrophoresis. Simultaneously, this assay was performed with individual ribonucleoprotein (RNP) complex or with different duplex combinations.

Comparison of β-carotene hydroxylase level in D. salina and its pigment analysis

Usually, carotenoids accumulated with increasing light emitting diode (LED) light intensity. So, Cells were grown under 12/12 light/dark (L/D) with 4000 Lux m−2 s−1 supplied by LED light to exponential growth phase and then exposed continuously to 6000 Lux m−2 s−1 LED light. After further growth for 24 h in white LED light, cultures were used to monitor the changes in the Dschyb mRNA levels and cellular carotenoids. After that, expression levels of Dschyb in different strains were examined by real-time fluorescent quantitative PCR (RT-qPCR). RT-qPCR reaction was conducted in 96-well plates containing cDNA template and gene specific primers (Table 3). At the same time, the housekeeping gene β-actin was used as an internal standard. Total RNA and cDNA amounts were determined with the NanoDrop One spectrophotometer (Thermo Scientific, Madison, USA). Subsequently, gene expression level was calculated by 2−∆∆Ct method with ABI 7500 manager program. On the other hand, biomass was harvested and extracted for high-performance liquid chromatography (HPLC) analysis as described by Xu et al. with slight modification (Xu and Harvey 2019). Using a Hypersil GOLD™ C-18 reverse phase (250 × 4.6 mm, 5 μm particle size) HPLC column (Thermo Scientific,Waltham, USA), β-carotene and zeaxanthin amounts were analyzed with an isocratic solvent system (90% methanol:10% acetonitrile) at 37℃ for 20 min and flow rate of 1 mL/min at a pressure of 78 bar. Standards for carotenoids (β-carotene and zeaxanthin) were obtained from Yuanye Biotech Co., Ltd (Shanghai, China) and dissolved in mobile phase to generate standard curves. Their quantities were performed at wavelengths of 450 nm with diode array detector (DAD) detector. Pigments were extracted from the 1 mL culture biomass using 1 mL of 80% (V/V) acetone, and placed at minus 20 degrees overnight. Before HPLC analysis, clarified samples were filtered with 0.22 µm filter into amber vials.

Table 3 The primers for RT-qPCR

Statistical analysis

In present study, differences of related gene expression between wild-type (WT) and mutant strain were statistically analyzed using one-way analysis of variance. The statistical significance of differences was determined using t-test and accepted when P value was less than 0.05. Data were plotted using GraphPad Prism software version 8.0 (GraphPad Software, San Diego, USA).


sgRNAs cleavage efficacy assay

Using primers of Dschyb (named as CHY-F and CHY-R), 1643 bp sgRNA-targeted fragments were amplified by PCR with WT D. salina genomes. After cleavage efficacy testing of three Cas9 RNP complexes, the results demonstrated that sgRNA1-Cas9 and sgRNA2-Cas9 complexes showed a 100% cleavage efficiency and yielded a band of expected size. As shown in Fig. 2, the former complex cleaved the target DNA fragment into a 646 bp and a 997 bp lane (Fig. 2 a1), while the latter complex cleaved the target template into a 1057 bp and a 586 bp lane (Fig. 2 a2). But the third complex (sgRNA3-Cas9) failed to cleave the target fragment which offers the third sgRNA is inactive (Fig. 2 a3). When using sgRNA and Cas9 protein alone, it was found that neither sgRNA nor Cas9 protein had cleavage activity to the target fragment. The complex becomes cleavage active only after they bound to each other. The reason mainly results from the different efficiency to CG content, presence of a guanine proximal to the PAM site, and the secondary structure of RNA fold (Jiang et al. 2014).

Fig. 2
figure 2

Analysis of sgRNA cleavage activity for target DNA. a Cleavage results of three sgRNA-Cas9 complexes to target DNA. b Cleavage results of single three sgRNAs to target DNA. TS: PCR products of target DNA; sgRNA: transcribed RNAs in vitro; Cas9: Cas9 protein; + : The plus represents the component in reaction system. −: The minus shows no this component in reaction system

D. salina transformation and identification of mutants

According to sgRNA preferred principle, three vectors were successfully constructed with conserved domains of Dschyb gene and confirmed by sequencing (Fig. 3). Based on test results, the effective pKSE401-sgRNA1 and pKSE401-sgRNA2 plasmids were used to transform the D. salina cells. Meanwhile, to increase the editing rate, the mixture of pKSE401-sgRNA1 and pKSE401-sgRNA2 has been used to transformed the D. salina cells. After transformation, six colonies were randomly selected and the Dschyb genes of each sample were amplified by colony PCR. As shown in Fig. 4, PCR products of three mutant strains showed a fragment of about 1 kb in length (Fig. 4, lane T2-4) which shorter than that of WT D. salina (Fig. 4, lane W, 1.6 kb). After gene sequencing, PCR products displayed overlapped peaks in the sequencing chromatography. The WT line and three isolates without target bands were picked for further analysis.

Fig. 3
figure 3

Sequencing identification of three sgRNA sequences (Gray parts represent the sgRNA base sequences)

Fig. 4
figure 4

The results for single algae colony PCR. W: Wild type D. salina strain; T1-6: Transformed D. salina lines

Expression of Dschyb gene in mutants

Through RT-qPCR analysis, relative expression levels of Dschyb mRNA in mutants were compared with those of WT. The results showed that, compared with the WT D. salina, the Dschyb mRNA levels in T2, T3 and T4 lines were reduced to 58%, 92.5%, and 56.5%, respectively (Fig. 5). In view of this, the expression of the edited Dschyb gene was significantly reduced in mutants. Unfortunately, none of the phenotype showed the complete silencing of Dschyb gene in D. salina. Under the light exposure, transcriptional level of Dschyb was up-regulated at 24 h and reached the highest level at 48 h (P < 0.01) in the WT cells. After constant exposure to strong light conditions, Dschyb mRNA of T3 and T4 lines reached the highest level at 24 h, while T2 was noted the highest level at 48 h. Nevertheless, the levels of Dschyb mRNA of mutant showed significantly decrease than that of WT cells after the high light stress.

Fig. 5
figure 5

Relative expression level of Dschyb gene at different times after exposure to high intensity LED light (Values represented as mean ± SD (n = 3)). W, W-24, W-48: The mRNA expression levels of Dschyb in WT strain which exposure to high light for 0 h, 24 h, and 48 h, respectively; T, T-24, T-48: The expression level of Dschyb in mutant which exposure to high light for 0 h, 24 h, and 48 h, respectively

Determination of carotenoid profile in mutants

Before HPLC analysis, the various parameters were determined, including elution temperature, and mobile phase. Because D. salina sample has the largest peak area at 35 °C, 35 °C was used as the most suitable temperature for elution (Fig. 6b). After DAD monitoring at 450 nm, zeaxanthin and β-carotene profile showed two detectable peaks at 4, 12 min separately (Fig. 6a–c). Based on calibration curves of respective standards (Fig. 6d, e), the carotenoid content of D. salina was calculated refer to the experimental section. Through HPLC analysis, the total carotenoids content of three mutants were significantly different from those of WT strains (Fig. 7a). Under the 24 h light stress, both WT and mutant lines showed the accumulation of β-carotenoids. Compared with other lines, T3 line showed the maximum accumulation of β-carotenoids, up to 1.4 µg/mL. At the same time, there were significant changes in the level of downstream zeaxanthin (Fig. 7b). The amount of zeaxanthin in WT line was already significantly decreased after high light treatment for 24 h. Only T2 lines rose slightly, the other two mutant lines were down. All these results demonstrated that Dschyb genes were successfully knocked-out and the gene was phenotypically silenced.

Fig. 6
figure 6

HPLC with diode-array detection and retention times of D. salina extracts at different temperatures. a HPLC chromatograms of WT D. salina extracts at 25 ℃ (Peak 1: zeaxanthin; Peak 2: β-carotene). b HPLC chromatograms of WT D. salina extracts at 35 ℃. c HPLC chromatograms of WT D. salina extracts at 40 ℃. d Standard curve of β-carotene. e Standard curve of zeaxanthin

figure 7

Content of β-carotene and zeaxanthin in D. salina after 24 h high light treatment (Values represented as mean ± SD (n = 3)). a The β-carotene content of WT strain and mutants after 24 h high light treatment. b The zeaxanthin content of WT strain and mutants after 24 h high light treatment


Although D. salina is a promising host for production of foreign proteins, it still faces many challenges in practical application, including the unclear genome background, unavailability of effective molecular tools, the low or inconsistent expression of recombinant proteins, and so on (Liang et al. 2020). In our previous works, the expression of various exogenous genes in D. salina cells was transient, like the human canstatin, and viral envelope proteins (Zhang et al. 2018). To overcome these obstacles of D. salina, the emergence of CRISPR/Cas system offers an excellent integration point and a robust and precise genome editing tool for development of D. salina system. Through non-homologous end joining and homologues directed repair, CRISPR/Cas9 system provided a more direct route for targeted mutagenesis, causing a ablation or insertion of specific genomic sequences on a single step. Moreover, it has advantages of easy design, simplicity, specificity, and capability of multiplex genome editing. With the completion of chloroplast genome sequencing in D. salina, the development of chloroplast expression system will become an attractive research direction ( Furthermore, using CRISPR technology to establish the nucleo-plasmic co-expression system of D. salina will become a more promising research direction, aiming to realize the high efficient production of exogenous genes.

Compared with the traditional transformation, RNP complex including preassembled Cas9 protein and sgRNA have enabled efficient genome editing in various hosts, such as animal, plants, human cells, and microalgae (DiNapoli et al. 2020; Xing et al. 2014; Kim et al. 2014; Liang et al. 2019). Owing to obviates the need for codon optimization or specific promoters, RNP delivery can be conveniently and rapidly applied in different species. Moreover, owing the degradation of Cas protein in cells by endogenous proteases, RNPs could reduce the off-target effects and mosaicism with a less cytotoxic in cells (Nomura et al. 2019). Simultaneously, the gene-edited plants and animals could be exempt from genetically modified regulations due to the absence of foreign DNA sequences (Kanchiswamy et al. 2015). Therefore, in order to further improve editing efficiency, our team will attempt to use RNP delivery system for gene editing of D. salina in next works. However, the disadvantages of RNP components need to be fully considered before the works, like the short half-life, and difficulty in transformation etc.

In conclusion, this study demonstrated that the specific-mutants of Dschyb have been successfully created with CRISPR/Cas9 system. After gene editing, Dschyb gene was knocked-out that induced a 2.2 fold increasing of β-carotene contents in mutant strains over than that of WT line. Owing to the first successful gene editing of D. salina, it has a very important practical significance for increasing carotene yield and meeting the realistic industry demand. Furthermore, this study not only provides an approach to overcome the current obstacles of D. salina, but also gives a strong tool to facilitates the development and application of D. salina system.

Availability of data and materials

The data of this article is included within the article. And also, the data and materials can also be requested from the corresponding author and the first author.


D. salina :

Dunaliella salina


Clustered regularly interspaced short palindromic repeat


Polymerase chain reaction


High-performance liquid chromatography


Single guide RNA


Real-time fluorescent quantitative PCR


Beta-carotene hydroxylase of D. salina




Light emitting diode


Diode array detector


Wild type


  • Berman J, Zorrilla-López U, Sandmann G, Capell T, Christou P, Zhu C (2017) The silencing of carotenoid β-hydroxylases by RNA interference in different maize genetic backgrounds increases the β-carotene content of the endosperm. Int J Mol Sci 18(12):2515

    Article  Google Scholar 

  • DiNapoli SE, Martinez MR, Gribbin CK, Wrighton PJ, Balgobin CA, Nelson I, Leonard A, Maskin CR, Shwartz A, Quenzer ED, Mailhiot D, Kao C, McConnell SC, de Jong JLO, Goessling W, Houvras Y (2020) Synthetic CRISPR/Cas9 reagents facilitate genome editing and homology directed repair. Nucleic Acids Res 48(7):e38

    CAS  Article  Google Scholar 

  • Fellmann C, Gowen BG, Lin PC, Doudna JA, Corn JE (2017) Cornerstones of CRISPR-Cas in drug discovery and therapy. Nat Rev Drug Discov 16(2):89–100

    CAS  Article  Google Scholar 

  • Feng S, Hu L, Zhang Q, Zhang F, Du J, Liang G, Li A, Song G, Liu Y (2020) CRISPR/Cas technology promotes the various application of Dunaliella salina system. Appl Microbiol Biotechnol 104(20):8621–8630

    Article  Google Scholar 

  • Jiang W, Brueggeman AJ, Horken KM, Plucinak TM, Weeks DP (2014) Successful transient expression of Cas9 and single guide RNA genes in Chlamydomonas reinhardtii. Eukaryot Cell 13(11):1465–1469

    Article  Google Scholar 

  • Kanchiswamy CN, Malnoy M, Velasco R, Kim JS, Viola R (2015) Non-GMO genetically edited crop plants. Trends Biotechnol 33(9):489–491

    CAS  Article  Google Scholar 

  • Khadempar S, Familghadakchi S, Motlagh RA, Farahani N, Dashtiahangar M, Rezaei H, Gheibi Hayat SM (2019) CRISPR-Cas9 in genome editing: its function and medical applications. J Cell Physiol 234(5):5751–5761

    CAS  Article  Google Scholar 

  • Kim SH, Ahn YO, Ahn MJ, Lee HS, Kwak SS (2012) Down-regulation of β-carotene hydroxylase increases β-carotene and total carotenoids enhancing salt stress tolerance in transgenic cultured cells of sweetpotato. Phytochemistry 74:69–78

    CAS  Article  Google Scholar 

  • Kim S, Kim D, Cho SW, Kim J, Kim JS (2014) Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res 24(6):1012–1019

    CAS  Article  Google Scholar 

  • Lamers PP, Janssen M, De Vos RCH, Bino RJ, Wijffels RH (2008) Exploring and exploiting carotenoid accumulation in Dunaliella salina for cell-factory applications. Trends Biotechnol 26(11):631–638

    CAS  Article  Google Scholar 

  • Liang MH, Wang L, Wang Q, Zhu J, Jiang JG (2019) High-value bioproducts from microalgae: strategies and progress. Crit Rev Food Sci Nutr 59(15):2423–2441

    CAS  Article  Google Scholar 

  • Liang ZC, Liang MH, Jiang JG (2020) Transgenic microalgae as bioreactors. Crit Rev Food Sci Nutr 60(19):3195–3213

    CAS  Article  Google Scholar 

  • Nomura T, Inoue K, Uehara-Yamaguchi Y, Yamada K, Iwata O, Suzuki K, Mochida K (2019) Highly efficient transgene-free targeted mutagenesis and single-stranded oligodeoxynucleotide-mediated precise knock-in in the industrial microalga Euglena gracilis using Cas9 ribonucleoproteins. Plant Biotechnol 17(11):2032–2034

    Article  Google Scholar 

  • Nymark M, Sharma AK, Sparstad T, Bones AM, Winge P (2016) A CRISPR/Cas9 system adapted for gene editing in marine algae. Sci Rep 6:24951

    CAS  Article  Google Scholar 

  • Saha SK, Kazipet N, Murray P (2018) The carotenogenic Dunaliella salina CCAP 19/20 produces enhanced levels of carotenoid under specific nutrients limitation. Biomed Res Int.

    Article  PubMed  PubMed Central  Google Scholar 

  • Sternberg SH, Redding S, Jinek M, Greene EC, Doudna JA (2014) DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 507(490):62–67

    CAS  Article  Google Scholar 

  • Vecchione S, Fritz G (2019) CRIMoClo plasmids for modular assembly and orthogonal chromosomal integration of synthetic circuits in Escherichia coli. J Bio Eng 13:92

    CAS  Article  Google Scholar 

  • Wichuk K, Brynjólfsson S, Fu W (2014) Biotechnological production of value-added carotenoids from microalgae: emerging technology and prospects. Bioengineered 5(3):204–208

    Article  Google Scholar 

  • Xi Y, Wang J, Xue S, Chi Z (2020) β-Carotene production from Dunaliella salina cultivated with bicarbonate as carbon source. J Microbiol Biotechnol 30(6):868–877

    Article  Google Scholar 

  • Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ (2014) A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Bio 14:327

    Article  Google Scholar 

  • Xu Y, Harvey PJ (2019) Red light control of β-carotene isomerisation to 9-cis β-carotene and carotenoid accumulation in Dunaliella salina. Antioxidants (basel) 8(5):148

    CAS  Article  Google Scholar 

  • Xu Y, Ibrahim IM, Wosu CI, Ben-Amotz A, Harvey PJ (2018) Potential of new isolates of Dunaliella salina for natural β-carotene production. Biology (basel) 7(1):E4

    Google Scholar 

  • Yang H, Wu JJ, Tang T, Liu KD, Dai C (2017) CRISPR/Cas9-mediated genome editing efficiently creates specific mutations at multiple loci using one sgRNA in Brassica napus. Sci Rep 7:7489

    Article  Google Scholar 

  • Zhang Z, He P, Zhou Y, Xie X, Feng S, Sun C (2018) Anti-HBV effect of interferon-thymosin α1 recombinant proteins in transgenic Dunaliella salina in vitro and in vivo. Exp Ther Med 16(2):517–522

    Article  Google Scholar 

Download references


The authors gratefully acknowledge Professor SHI Gongyao of Life Science College of Zhengzhou University for presenting plasmid pKSE401.


This study was founded by the National Natural Science Foundation of China (No. U1804112, 31571289), and the Zhongjing Core Scholar’s Research Initial Fund of Henan University of Chinese Medicine (No. 00104311-2020-1).

Author information

Authors and Affiliations



LN, SY wrote the manuscript. LN, JX, GF made the table. LN, SY, AF drew the pictures. SY, LN, CL conduct the HPLC analysis. All authors read and approved the manuscript.

Corresponding author

Correspondence to Shuying Feng.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no conflicts of interest in relation to this research and its publication.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Hu, L., Feng, S., Liang, G. et al. CRISPR/Cas9-induced β-carotene hydroxylase mutation in Dunaliella salina CCAP19/18. AMB Expr 11, 83 (2021).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:


  • D. salina
  • CRISPR/Cas9
  • β-carotene hydroxylase
  • Knockout
  • Mutant