Skip to content

Advertisement

  • Original article
  • Open Access

Development and validation of a TaqMan RT-PCR method for identification of mayonnaise spoilage yeast Pichia kudriavzevii

AMB Express20188:186

https://doi.org/10.1186/s13568-018-0716-y

  • Received: 7 July 2018
  • Accepted: 17 November 2018
  • Published:

Abstract

Food spoilage and its contamination with yeast and mold is a serious problem of food industry. Despite the high fat content, mayonnaise is an attractive substrate for food spoilage microorganisms. The aim of this study was to develop a method for yeast identification in mayonnaise and to test commercially available mayonnaises for the presence of these contaminating microorganisms. Based on the sequencing of intergenic regions ITS1 and ITS2, we identified a yeast microorganism that causes mayonnaise spoilage. We found that DNA sequences were more than 99% identical to the GenBank DNA sequences from Pichia kudriavzevii. We developed a specific to P. kudriavzevii TaqMan probe and primers. The reaction conditions were optimized regarding to the components concentration and temperature cycle. The minimum amount of P. kudriavzevii DNA that could be detected by developed method was 50 fg. The minimal number of P. kudriavzevii cells that could be detected by developed method without pre-enrichment was 50. We tested verified method with DNAs from microorganisms of different taxonomic groups that were obtained from three collections of microorganisms. Finally, we analyzed 20 different brands of mayonnaise from 14 producers and 10 different brands of mayonnaise sauce from seven producers. We determined the Cq parameter that characterizes transition of the fluorescence curve to the logarithmic phase and, therefore, correlates with the extent of sample contamination with P. kudriavzevii yeast. P. kudriavzevii was detected in six analyzed samples of mayonnaise and one sample of mayonnaise sauce.

Keywords

  • Mayonnaise spoilage
  • Pichia kudriavzevii
  • TaqMan
  • Identification
  • Mayonnaise screening

Introduction

Food spoilage and its contamination with pathogenic microorganisms is a serious problem of food industry. Often, contaminating agents are eukaryotic microorganisms, such as yeast and molds. Microbial contamination is very common for the products with a high fat content, e.g., mayonnaises. Mayonnaise is a semi-liquid emulsion of oil, egg yolks, whole eggs, vinegar, and/or lemon juice and some other ingredients (salt, spices, glucose, etc.) with pH 3.6 to 4.6 (Jay et al. 2005). The risk of spoilage is exacerbated by the refusal of food-producing companies to use preservatives. Despite the high fat content, mayonnaise is an attractive substrate for food spoilage microorganisms and even some pathogenic microbes. One of the first studies on mayonnaise contamination was performed by Fabian and Wethington (1950), who identified yeast in mayonnaise samples; other authors have demonstrated later that yeast, e.g., Saccharomyces bailii, often contaminates mayonnaise (Kurtzman et al. 1971). The prevalent contaminating bacteria in mayonnaises are halophilic/halotolerant species, such as Micrococcus and Bacillus (Sagdic et al. 2017).

Among potential sources of microbial contamination are eggs, because egg yolk is one of the main mayonnaise ingredients. Bacteria, such as Escherichia coli, Shigella spp. and yeasts, such as Candida albicans (Lee et al. 2017), and Coxiella burnetii (Tatsumi et al. 2006) were found in eggs; for the latter, the identification method using real-time PCR has been developed (Sadamasu et al. 2006). In another study, Candida sp. was found in 231 out of 380 mayonnaise samples tested (Musgrove et al. 2008). Other common eukaryotic egg-contaminating microorganisms are molds, mostly from the genera Mucor, Penicillium, Hormodendron, and Cladosporium; Penicillium and Cladosporium being the most frequent causes for fungal spoilage of eggs (Jay et al. 2005). Representatives of other genera, such as Cryptococcus, Hansenula, Hyphopichia, Metschnikowia, Rhodotorula, Sporobolomyces, and Torulaspora have been identified in eggs as well. The most dangerous mayonnaise-contaminating microorganism is Salmonella. In Rio Grande do Sul (Brazil), homemade mayonnaise accounts for 17% cases of salmonellosis (Capalonga et al. 2014). Changes in pH and temperature can control the growth of Salmonella enteritidis (Keerthirathne et al. 2016), and the model describing the growth of this microorganism in mayonnaise at different temperatures has been proposed (Elias et al. 2016).

Scientists have also been searching for biologically active compounds capable of inhibiting microbial growth in mayonnaise. For example, chitosan was found to suppress the growth of Lactobacillus, but not of the yeast Saccharomyces bailii (Oh et al. 2001).

The common method for identification of microorganisms in mayonnaise is microbial plating on a nutrient medium; however, molecular genetic methods have also gained a wide recognition, because these methods are considerably less time-consuming. Thus, real-time PCR method was suggested for Shigella sp. detection (Villalobo and Torres 1998) and successfully used for Salmonella enterica identification in mayonnaise (Almeida et al. 2013). Another real-time PCR-based system (MicroSEQ® L. monocytogenes Detection Kit) was used for Listeria monocytigenes detection in mayonnaise-containing food products (Tebbs et al. 2011). A method for differentiation of contaminating yeasts have been developed based on the high-resolution melting analysis (Erdem et al. 2016); however, this method did not provide rapid and precise identification of Pichia spp.

The aim of this study was to develop a method for yeast identification in mayonnaise and to test commercially available mayonnaises for the presence of these contaminating microorganisms.

Materials and methods

Samples

Commercially available mayonnaises and mayonnaise sauces of different brands available in Russia market were bought for testing and stored at + 4 °C in sealed packaging before analysis.

Microbiological analysis

To test for microbial contamination, mayonnaise samples (1 ml) were diluted two times and plated on the medium containing 40 g/l glucose, 10 g/l peptone, and 15 g/l agar. All medium components were dissolved in hot water, and pH was adjusted so that pH after sterilization was 6.5 at 25 °C. Chloramphenicol was added at a final concentration of 50 mg/l.

To enrich yeast cells, mayonnaise samples (1 ml) were enriched by incubating for 19 h in 30 ml of Sabouraud broth containing 20 g/l peptone and 40 g/l glucose, and then centrifuged for 5 min at 10,000g. The resulting pellet was used for DNA isolation.

Molecular identification of yeasts

DNA from the grown colonies was isolated using commercially available PROBA-GS kit (DNA Technology, Russia). Polymerase chain reaction was performed with an Eppendorf MasterCycler Personal cycler. Each PCR reaction mixture contained 2.5 µl of 10× reaction buffer, 1 µl of 10 mM dNTPs, 1 µl of 10 µM forward primer, 1 µl of 10 µM reverse primer, 3 µl of 25 mM Mg2+, 1 µg of template DNA, 2.5 units of thermostable Taq DNA polymerase (Evrogen, Russia), and deionized water (up to 25 μl). PCR regime included initial denaturation at 94 °C for 5 min; 35 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 30 s, elongation at 72 °C for 45 s; final elongation at 72 °C for 10 min. Fungal-specific primers for molecular identification were: direct ITS1 primer—5′-TCCGTAGGTGAACCTGCGG; reverse ITS4 primer—5′-TCCTCCGCTTATTGATATGC (White et al. 1990).

PCR products were stained with ethidium bromide and visualized at 312 nm with a TCO-20LM transilluminator after electrophoresis in 2% agarose gel.

RCR products were purified from the gel with a Cleanup Standard kit (Evrogen, Russia) and sequenced with an Applied Biosystems 3500 automated sequencer using a BigDye Terminator v3.1 Cycle Sequencing Kit and ITS1/ITS4 primers.

Development TaqMan RT-PCR

Nucleotide sequence alignment was carried out in MEGA6 tool (Tamura et al. 2013). Primer/probe sets for identification of P. kudriavzevii were designed according to the following criteria: primer length between 18 and 30 bp; no distinctive hairpin structures and dimers; GC content from 20 to 80%; minimal G/C content at the 3′ end of the primers; minimum identical nucleotides together in TaqMan probes; no G at the probe 5′-end; PCR-product size from 80 to 250 bp; annealing temperature of the probe at least 4 °C above annealing temperature of the primers.

Real-time PCR was carried out in a Bio-Rad CFX96 Real-time PCR Detection System (Bio-Rad, USA) using commercially available qPCRmix-HS mixture (Eurogen, Russia) according to the following protocol: initial denaturation at 94 °C for 5 min; 37 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 30 s, elongation at 72 °C for 30 s.

Results

Bioinformatics analysis and primer/probe design

To identify contaminating yeast species, we selected eight commercially available mayonnaise samples and plated them on agar plates. After 3-day growth, yeast-resembling colonies were isolated for further molecular biological studies. Yeast presence was found in four samples of mayonnaise. After DNA isolation we sequenced the DNA fragments that contained 5.8S rRNA gene and two internally transcribed spacers, ITS1 and ITS2 and compared them to nucleotide sequences from the GenBank database. We found out that all sequences were more than 99% identical to the DNA sequences from P. kudriavzevii. The sequenced fragments were also analyzed using the data from the Boldsystem (http://www.boldsystems.org) that confirmed that the identified microorganism was P. kudriavzevii. The obtained sequences were deposited in the Genbank database under the corresponding numbers: MH626402.1, MH626403.1, MH626404.1, MH626405.1, MH626406.1, MH626407.1, MH626408.1 and MH626409.1.

We analyzed over 180 registered in GenBank DNA sequences of 5.8S, 18S and 28S ribosomal RNA genes and internally transcribed spacers ITS1 and ITS2 for P. kudriavzevii and synonymic species (Issatchenkia orientalis, Candida krusei) to identify specific sequences. The primer/probe sets for identification of P. kudriavzevii were suggested (Table 1).
Table 1

Suggested primers and TaqMan probes for identification of P. kudriavzevii

Primer/probe set

Nucleotide sequences

PCR product length, b.p.

1

Forward primer GAATTGCAGCCATCGTGAATC

TaqMan probe FAM-TCGTTTCCATCTTGCGCGTGC-BHQ1

Reverse primer CTCCGACGCTCTTTACACG

149

2a

Forward primer GCGAAATGCGATACCTAGTG

TaqMan probe FAM-TGCAGCCATCGTGAATCATCGAGT-BHQ1

Reverse primer GATGGAAACGACGCTCAAA

114

3

Forward primer GCGGACGACGTGTAAAG

TaqMan Probe FAM-GAGCGAGTGTTGCGAGACAACAA-BHQ1

Reverse primer CGGGTATTCCTACCTGATTTG

156

4

Forward primer GAGCGTCGTTTCCATCTT

TaqMan probe FAM-CAGCTCCGACGCTCTTTACACGTC-BHQ1

Reverse primer CAGCTTCGCTCCCTTTC

102

5

Forward primer GATCTCTTGGTTCTCGCATC

TaqMan probe FAM-CACACTAGGTATCGCATTTCGCTGC-BHQ1

Reverse primer GCGTTCAAGAACTCGATGA

92

6

Forward primer GCAGCCATCGTGAATCAT

TaqMan probe FAM-TTTGAGCGTCGTTTCCATCTTGCG-BHQ1

Reverse primer AGCTCCGACGCTCTTTA

146

a The most optimal primer/probe sets for identification of P. kudriavzevii

More rigorous analysis of the designed primer/probe sets revealed possible heterodimer (8 nucleotides) formation between the TaqMan probe and direct primer and between the TaqMan probe and reverse primer in the primer/probe sets 4 and 6, respectively, so they were omitted from further study. The remaining four primer/probe sets were synthesized and verified in real-time PCR with yeast DNA. No TaqMan probe hybridization was observed for the sets 1 and 3; out of sets 2 and 4, TaqMan probe from set 2 hybridized more strongly and at earlier PCR cycles, so this primer/probe set was used in further studies. Specificity to P. kudriavzevii DNA mostly provides TaqMan probe and a reverse primer from set 2. The site for TaqMan probe hybridization is specific for this yeast. Homologous sites of the TaqMan probe hybridization to DNA of the closest eukaryotic microorganisms registered in the GenBank are shown in Fig. 1.
Fig. 1
Fig. 1

Homologous sequences of the P. kudriavzevii DNA and DNA of other closest eukaryotic microorganisms

The site for attaching the TaqMan probe to DNA was highly specific to this species of yeast. There was no variability of this site inside the P. kudriavzevii species. However, it was found that there is still a small probability of a positive TaqMan reaction with DNA from yeasts that phylogenetically most close to Pichia sp.—Martiniozyma sp. and Saturnispora sp. (Fig. 2).
Fig. 2
Fig. 2

Sites for primers and TaqMan probe hybridization of P. kudriavzevii DNA and Martiniozyma sp. and Saturnispora sp. DNA

Based on the PCR product expected size and the primer annealing temperature, the PCR regime used was as follows: 94 °C for 4 min followed by 37 cycles of 94 °C for 30 s, 50–58 °C for 30 s, 72 °C for 30 s. We ran the reaction at five different primer annealing temperatures: 50, 52, 54, 56, and 58 °C. At all the temperatures tested, the fluorescence curve reached the logarithmic phase at the same cycle number, although the total levels of fluorescence were higher at 50, 52, and 54 °C. Since higher primer annealing temperatures increase primer specificity, 54 °C was chosen as the optimal primer annealing temperature in our experiments. We also tested the effect of TaqMan probe concentration (100, 200, and 500 nM) on the reaction parameters and found that amplification using 200 nM TaqMan probe produced more stable and pronounced amplification curves; the total level of fluorescence with 200 nM TaqMan probe was higher than when using 100 nM TaqMan probe. The optimal number of cycles was 37, because in such a number of cycles fluorescence was not observed in samples without P. kudriavzevii DNA.

Estimation of method sensitivity

DNA was isolated from P. kudriavzevii culture and diluted to 1 ng/μl, diluted 1: 10, 1: 100, 1:1000, and 1: 10,000, and used as a template in real-time PCR with the developed primer/probe set (1 μl per reaction tube), see Fig. 3. The linear dependence of the Cq parameter on the concentration of the genomic DNA of P. kudriavzevii was observed (Fig. 4), which means that the reaction is specific only to the target DNA without the formation of non-specific products.
Fig. 3
Fig. 3

The influence of different amount of P. kudriavzevii genomic DNA per reaction and Cq parameter

Fig. 4
Fig. 4

The dependence of Cq parameter on concentration of genomic DNA of P. kudriavzevii

The minimum amount of Pichia sp. DNA that could be detected by our method was 50 fg. To estimate the minimal number of live cells sufficient for P. kudriavzevii detection, total DNA was isolated from 10, 50, 100, 1000, and 10,000 cells of P. kudriavzevii and used as a template in the same PCR. The minimal number of yeast that could be detected by our method without pre-enrichment was 50 cells.

Verification of the specificity of the developed primer/probe set for Pichia kudriavzevii

To verify the specificity of the developed primer/probe, we tested it in PCR with DNAs from microorganisms of different taxonomic groups that were obtained from the Russian Collection of Microorganisms (VKM) at the Skryabin Institute of Microbial Biochemistry and Physiology (Pushchino, Russia), State collection of microorganisms that cause dangerous, particularly dangerous, including zooanthroponotic animals diseases (VKOM) at the Federal Research Center for Virology and Microbiology (Pokrov, Russia) and Russian collection of industrial microorganisms (VKMP) State Research Institute of Genetics and Selection of Industrial Microorganisms (Moscow, Russia) (Table 2).
Table 2

Verification of the specificity of the developed method with microorganisms from different taxonomic groups

Organism

Collection

Collection number or strain

Reaction with TaqMan

Mold and yeast

Alternaria alternata

VKPM

F300

Aspergillus flavus

VKPM

F1271

Aspergillus carbonarius

VKPM

F301

Chaetomium globosum

VKPM

F323

Fusarium verticillioides

VKPM

F206

Geotrichum candidum

VKPM

F220

Penicillium funiculosum

VKPM

F977

Penicillium pinophilum

VKPM

F896

Phanerochaete chrysosporium

VKPM

F615

Phlebia albida

VKPM

F507

Pleurotus ostreatus

VKPM

F276

Trichoderma reesei

VKPM

F184

Trichoderma viride

VKPM

F179

Brettanomyces custersianus

VKM

Y-1419

Candida pseudotropicalis

VKPM

Y190

Candida tropicalis

VKPM

Y143

Dekkera anomala

VKM

Y-19

Pichia fermentans

VKM

Y-244

+

Pichia kudriavzevii

VKM

Y-184

+

Pichia membranifaciens

VKM

Y-248

+

Saccharomyces cerevisiae

VKPM

Y2396

Yarrowia lipolytica

VKPM

Y34

Zygosaccharomyces rouxii

VKM

Y-866

Bacteria

Bacillus subtilis

VKPM

B5250

Cellulomonas flavigena

VKPM

B2560

Corynebacterium glutamicum

VKPM

B1003

Lactobacillus plantarum

VKPM

B3487

Pseudomonas fluorescens

VKM

B-894

Streptomyces fulvoviridis

VKPM

AC-605

Listeria monocytogenes

VKOM

766

Staphylococcus aureus

VKOM

209-P

Pseudomonas aeruginosa

VKOM

273

Bacillus cereus

VKOM

96

Escherichia coli

VKOM

К12

Salmonella enteritidis

VKOM

5765

Listeria ivanovii

VKOM

7842

Micrococcus luteus

VKOM

4698 ATCC

Rhodococcus equi

VKOM

5869

PCR proceeded only with microorganisms from the Pichia genus. No increase in fluorescence was observed for other yeast, molds and bacteria. We also contaminated 23 samples of preliminary tested microbe-free mayonnaise with P. kudriavzevii. After these samples were enriched, DNA was isolated and used in the real-time PCR with the developed primer/probe set. In all 23 cases, the reaction was positive, i.e., the reproducibility of the method was 100%.

Testing commercially available mayonnaises and mayonnaise sauces for microbial contamination

We analyzed 20 different brands of mayonnaise from 14 producers and 10 samples of mayonnaise sauce from seven different brands. We determined the Cq parameter that characterizes transition of the fluorescence curve to the logarithmic phase and, therefore, correlates with the extent of sample contamination with P. kudriavzevii yeast.

The increase in fluorescence was observed in six analyzed samples of mayonnaise: sample 1 (Cq = 20,13), sample 13 (Cq = 31,70), sample 14 (Cq = 28,61), sample 15 (Cq = 30,40), sample 17 (Cq = 33,95) and sample 17 (Cq = 34,50). 1. The increase in fluorescence was observed in sample 1 of mayonnaise sauce (Cq = 34,86). The Cq values for the “positive” samples differed, thereby indicating different extents of contamination with P. kudriavzevii.

Discussion

Detection and quantitative estimation of yeast and mold contamination is a sanitary requirement for most food products, although contaminating microorganisms are not usually identified to genera or species. Different yeast and molds might develop differently in different food products. The yeast P. kudriavzevii, that were identified by us in mayonnaise samples, tolerate high fat content and low pH and were detected in Chinese vinegar (Li et al. 2014). P. fermentas were found in freshly cut apples (Graça et al. 2015); P. anomala were identified in maize silage that it characterized by low pH values (Santos et al. 2017). Pichia yeast has been also found in other products: P. guilliermondii (Sangorrin et al. 2013), P. membranifaciens, and P. manshurica contaminate wines; P. fermentans and P. kudriavzevii were found in cheeses (Gonçalves Dos Santos et al. 2017). Also, yeasts of these taxonomic groups were identified in products with high fat content (Arroyo-Lopez et al. 2012). Therefore, early detection of P. kudriavzevii yeast will ensure removal of contaminated products from realization and eliminate the use of infected ingredients in the production of mayonnaise and mayonnaise sauces.

In this study, we developed a primer/probe set to a region of Pichia genome that included internally transcribed spacer ITS1, 5.8S rRNA gene and internally transcribed spacer ITS2. This region was chosen because the information on its nucleotide sequence in many organisms (including Pichia yeast) is widely available in sequence databases, such as GenBank. In addition, the genomic DNA of eukaryotic microorganisms contains this region in several copies. This increases the sensitivity of the method. Using this information, we were able to identify taxon-characteristic conserved nucleotide sequences and to develop a corresponding probe/primer set for P. kudriavzevii identification. The primer/probe set used in this study was highly specific and did not anneal to the DNA from other than Pichia microorganisms. The sensitivity of our method without pre-enrichment was 50 yeast cells.

We have found that primers and the TaqMan probe can react with DNA of other species from the Pichia genus. Given the purpose for which the identification system was developed (detection of mayonnaise spoilage yeast), this fact does not have any negative impact. For the same reason, the hypothetical interaction of the developed TaqMan probe with DNA of Martiniozyma sp. and Saturnispora sp. also will not have a negative effect, because these yeasts are very close to Pichia sp. (Kurtzman et al. 2008; Kurtzman 2015). We couldn’t check experimentally whether there is a TaqMan probe interaction with DNA of these microorganisms because we did not have verified collection strains of the Martiniozyma sp. and Saturnispora sp.

The developed method for rapid identification of Pichia yeast using real-time PCR reduces the time required for analysis from 5 days to 24 h, which allows rapid detection of contamination source and timed removal of the contaminated produce.

Molecular genetic identification of microorganisms in food products with high fat content (such as mayonnaise) is often impeded by the difficulties in the DNA isolation. In the procedure developed by us, yeast cells were concentrated by centrifugation after preliminary enrichment of the culture. By doing this, we solved both methodical problems, i.e., we increased the method sensitivity by enriching the microorganism culture and removed fats that interfered with DNA isolation.

The developed procedure is rapid and simple and could be carried out in any laboratory equipped with a real-time PCR system. It could also be used for testing other food products.

Screening of commercially available mayonnaises and mayonnaise sauces demonstrated that 6 out of 20 mayonnaises and 1 out of 10 mayonnaise sauces were contaminated with Pichia yeast.

As follows from the high Cq value, one of the mayonnaise samples displayed an extremely high abundance of Pichia sp. cells; two other samples were moderately contaminated, and the rest of the samples exhibited low extent of yeast contamination.

Note that the positive count in mayonnaises was higher than in mayonnaise sauces due, probably, to the fact that mayonnaise sauces contain preservatives, while mayonnaises are often positioned as “organic” products free of chemical additives, such as preservatives or aromatic compounds.

In conclusion, we identified yeasts that able to contaminate mayonnaise. Based on the sequencing of intergenic regions ITS1 and ITS2, we shown that spoilage mayonnaise yeasts are P. kudriavzevii. We developed a specific to P. kudriavzevii TaqMan probe and primers. The reaction was optimized for the components concentration and temperature cycle. The minimal number of yeast cells that could be detected by our method without pre-enrichment was 50 cells. Screening of commercially available mayonnaises and mayonnaise sauces demonstrated that 6 out of 20 mayonnaises and 1 out of 10 mayonnaise sauces were contaminated with Pichia yeast. The developed procedure is rapid and simple and could be carried out in any laboratory equipped with a real-time PCR system.

Abbreviations

DNA: 

deoxyribonucleic acid

RNA: 

ribonucleic acid

PCR: 

polymerase chain reaction

ITS: 

internal transcribed spacer

Declarations

Authors’ contributions

MS carried out molecular genetic studies and wrote the manuscript; SK performed microbiological and molecular genetics experiments; VN analyzed the data. All authors read and approved the final manuscript.

Acknowledgements

We thank Anastasia Kokina and Olga Savinkova for their experimental assistance. We also thank EFKO Group of Companies for provision of materials for analysis.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article.

Consent for publication

Not applicable.

Ethics approval and consent to participate

This article does not contain any studies with human participants or animals performed by any of the authors.

Funding

This study was supported by Ministry of Education and Science of the Russian Federation (Agreement N 14.577.21.0257, unique agreement code RFMEFI57717X0257).

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors’ Affiliations

(1)
Department of Genetic, Cytology and Bioengineering, Voronezh State University, 1 Universitetskaya pl., Voronezh, 394018, Russia
(2)
Innovative Center “Biruch-NT”, EFKO Group of Companies, Malybykovo, 1 Belaya Vezha Str., Belgorod Region, 309927, Russia

References

  1. Almeida C, Cerqueira L, Azevedo NF, Vieira MJ (2013) Detection of Salmonella enterica serovar enteritidis using real time PCR, immunocapture assay, PNA FISH and standard culture methods in different types of food samples. Int J Food Microbiol 161(1):16–22. https://doi.org/10.1016/j.ijfoodmicro.2012.11.014 View ArticlePubMedGoogle Scholar
  2. Arroyo-Lopez FN, Romero-Gil V, Bautista-Gallego J, Rodriguez-Gomez F, Jimenez-Diaz R, Garcia-Garcia P, Querol A, Garrido-Fernandez A (2012) Yeasts in table olive processing: desirable or spoilage microorganisms? Int J Food Microbiol 160(1):42–49. https://doi.org/10.1016/j.ijfoodmicro.2012.08.003 View ArticlePubMedGoogle Scholar
  3. Capalonga R, Ramos RC, Both JM, Soeiro ML, Longaray SM, Haas S, Tondo EC (2014) Salmonella serotypes, resistance patterns, and food vehicles of salmonellosis in southern Brazil between 2007 and 2012. J Infect Dev Ctries 8(7):811–817. https://doi.org/10.3855/jidc.3791 View ArticlePubMedGoogle Scholar
  4. Elias SO, Alvarenga VO, Longhi DA, Sant’Ana ADS, Tondo EC (2016) Modeling growth kinetic parameters of Salmonella enteritidis SE86 on homemade mayonnaise under isothermal and nonisothermal conditions. Foodborne Pathog Dis 13(8):462–467. https://doi.org/10.1089/fpd.2015.204 View ArticleGoogle Scholar
  5. Erdem M, Kesmen Z, Özbekar E, Çetin B, Yetim H (2016) Application of high-resolution melting analysis for differentiation of spoilage yeasts. J Microbiol 54(9):618–625. https://doi.org/10.1007/s12275-016-6017-8 View ArticlePubMedGoogle Scholar
  6. Fabian FW, Wethington MO (1950) Bacterial and chemical analyses of mayonnaise, salad dressing, and related products. J Food Sci 15(2):138–145. https://doi.org/10.1111/j.1365-2621.1950.tb16460.x View ArticleGoogle Scholar
  7. Gonçalves Dos Santos MTP, Benito MJ, Cordoba MG, Alvarenga N, de Herrera SRMS (2017) Yeast community in traditional Portuguese Serpa cheese by culture-dependent and -independent DNA approaches. Int J Food Microbiol 262:63–70. https://doi.org/10.1016/j.ijfoodmicro.2017.09.013 View ArticlePubMedGoogle Scholar
  8. Graça A, Santo D, Esteves E, Nunes C, Abadias M, Quintas C (2015) Evaluation of microbial quality and yeast diversity in fresh-cut apple. Food Microbiol 51:179–185. https://doi.org/10.1016/j.fm.2015.06.003 View ArticlePubMedGoogle Scholar
  9. Jay JM, Loessner MJ, Golden DA (2005) Modern food microbiology, 7th edn. Springer, New YorkGoogle Scholar
  10. Keerthirathne TP, Ross K, Fallowfield H, Whiley H (2016) A review of temperature, pH, and other factors that influence the survival of Salmonella in mayonnaise and other raw egg products. Pathogens 5(4):63. https://doi.org/10.3390/pathogens5040063 View ArticlePubMed CentralGoogle Scholar
  11. Kurtzman CP (2015) Description of Martiniozyma gen. nov. and transfer of seven Candida species to Saturnispora as new combinations. Antonie Van Leeuwenhoek 108(4):803–809. https://doi.org/10.1007/s10482-015-0536-x View ArticlePubMedGoogle Scholar
  12. Kurtzman CP, Rogers R, Hesseltine CW (1971) Microbiological spoilage of mayonnaise and salad dressings. Appl Microbiol 21(5):870–874PubMedPubMed CentralGoogle Scholar
  13. Kurtzman CP, Robnett CJ, Basehoar-Powers E (2008) Phylogenetic relationships among species of Pichia, Issatchenkia and Williopsis determined from multigene sequence analysis, and the proposal of Barnettozyma gen. nov., Lindnera gen. nov. and Wickerhamomyces gen. nov. FEMS Yeast Res 8(6):939–954. https://doi.org/10.1111/j.1567-1364.2008.00419.x View ArticlePubMedGoogle Scholar
  14. Lee SI, Lee H, Jablonski PG, Choe JC, Husby M (2017) Microbial abundance on the eggs of a passerine bird and related fitness consequences between urban and rural habitats. PLoS ONE 12(9):e0185411. https://doi.org/10.1371/journal.pone.0185411 View ArticlePubMedPubMed CentralGoogle Scholar
  15. Li P, Li S, Cheng L, Luo L (2014) Analyzing the relation between the microbial diversity of DaQu and the turbidity spoilage of traditional Chinese vinegar. Appl Microbiol Biotechnol 98(13):6073–6084. https://doi.org/10.1007/s00253-014-5697-4 View ArticlePubMedGoogle Scholar
  16. Musgrove MT, Jones DR, Hinton A Jr, Ingram KD, Northcutt JK (2008) Identification of yeasts isolated from commercial shell eggs stored at refrigerated temperatures. J Food Prot 71(6):1258–1261. https://doi.org/10.4315/0362-028X-71.6.1258 View ArticlePubMedGoogle Scholar
  17. Oh HI, Kim YJ, Chang EJ, Kim JY (2001) Antimicrobial characteristics of chitosans against food spoilage microorganisms in liquid media and mayonnaise. Biosci Biotechnol Biochem 65(11):2378–2383. https://doi.org/10.1271/bbb.65.2378 View ArticlePubMedGoogle Scholar
  18. Sadamasu K, Tabei Y, Shinkai T, Hasegawa M, Kaneko S, Hirai A, Nakama A, Ishizaki N, Odagiri M, Kamata S, Yano K, Kai A, Morozumi S (2006) Development of effective detection method for Coxiella burnetii in mayonnaise by real-time PCR and investigation of C. burnetii contamination in commercial mayonnaise in Tokyo. Shokuhin Eiseigaku Zasshi 7(1):1–8. https://doi.org/10.3358/shokueishi.47.1 View ArticleGoogle Scholar
  19. Sagdic O, Tornuk F, Karasu S, Durak MZ, Arici M (2017) Microbial ecology of mayonnaise, margarine, and sauces. Quant Microbiol Food Process Model Microb Ecol. https://doi.org/10.1002/9781118823071.ch26 View ArticleGoogle Scholar
  20. Sangorrin MP, Garcia V, Lopes CA, Saez JS, Martinez C, Gang MA (2013) Molecular and physiological comparison of spoilage wine yeasts. J Appl Microbiol 14(4):1066–1074. https://doi.org/10.1111/jam.12134 View ArticleGoogle Scholar
  21. Santos MC, Golt C, Joerger RD, Mechor GD, Mourão GB, Kung L Jr (2017) Identification of the major yeasts isolated from high moisture corn and corn silages in the United States using genetic and biochemical methods. J Dairy Sci 100(2):1151–1160. https://doi.org/10.3168/jds.2016-11450 View ArticlePubMedGoogle Scholar
  22. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729. https://doi.org/10.1093/molbev/mst197 View ArticlePubMedPubMed CentralGoogle Scholar
  23. Tatsumi N, Baumgartner A, Qiao Y, Yamamoto I, Yamaguchi K (2006) Detection of Coxiella burnetii in market chicken eggs and mayonnaise. Ann N Y Acad Sci 1078:502–505. https://doi.org/10.1196/annals.1374.096 View ArticlePubMedGoogle Scholar
  24. Tebbs RS, Balachandran P, Wong LY, Zoder P, Furtado MR, Petrauskene OV, Cao Y (2011) Evaluation of applied biosystems MicroSeq real-time PCR system for detection of Listeria monocytogenes in food. Performance tested method 011002. J AOAC Int 94(5):1481–1489View ArticleGoogle Scholar
  25. Villalobo E, Torres A (1998) PCR for detection of Shigella spp. in mayonnaise. Appl Environ Microbiol 64(4):1242–1245PubMedPubMed CentralGoogle Scholar
  26. White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols: a guide to methods and applications. Academic Press, New York, pp 315–322Google Scholar

Copyright

© The Author(s) 2018

Advertisement