Skip to main content

Table 1 Suggested primers and TaqMan probes for identification of P. kudriavzevii

From: Development and validation of a TaqMan RT-PCR method for identification of mayonnaise spoilage yeast Pichia kudriavzevii

Primer/probe set Nucleotide sequences PCR product length, b.p.
1 Forward primer GAATTGCAGCCATCGTGAATC
TaqMan probe FAM-TCGTTTCCATCTTGCGCGTGC-BHQ1
Reverse primer CTCCGACGCTCTTTACACG
149
2a Forward primer GCGAAATGCGATACCTAGTG
TaqMan probe FAM-TGCAGCCATCGTGAATCATCGAGT-BHQ1
Reverse primer GATGGAAACGACGCTCAAA
114
3 Forward primer GCGGACGACGTGTAAAG
TaqMan Probe FAM-GAGCGAGTGTTGCGAGACAACAA-BHQ1
Reverse primer CGGGTATTCCTACCTGATTTG
156
4 Forward primer GAGCGTCGTTTCCATCTT
TaqMan probe FAM-CAGCTCCGACGCTCTTTACACGTC-BHQ1
Reverse primer CAGCTTCGCTCCCTTTC
102
5 Forward primer GATCTCTTGGTTCTCGCATC
TaqMan probe FAM-CACACTAGGTATCGCATTTCGCTGC-BHQ1
Reverse primer GCGTTCAAGAACTCGATGA
92
6 Forward primer GCAGCCATCGTGAATCAT
TaqMan probe FAM-TTTGAGCGTCGTTTCCATCTTGCG-BHQ1
Reverse primer AGCTCCGACGCTCTTTA
146
  1. a The most optimal primer/probe sets for identification of P. kudriavzevii