Skip to content

Advertisement

AMB Express

AMB Express Cover Image
  • Original article
  • Open Access

Loop-mediated isothermal amplification of Neisseria gonorrhoeae porA pseudogene: a rapid and reliable method to detect gonorrhea

  • 1,
  • 1,
  • 2,
  • 3 and
  • 1Email author
AMB Express20177:48

https://doi.org/10.1186/s13568-017-0349-6

©  The Author(s) 2017

Received: 5 July 2016

Accepted: 17 February 2017

Published: 23 February 2017

Abstract

Background and objective

Gonorrhea is a sexually transmitted disease caused by the bacterium Neisseria gonorrhoeae. Rapid detection is crucial for effective prevention and treatment. This study developed and tested a low-cost effective method for detecting N. gonorrhoeae, especially in developing countries.

Methods

DNA from a N. gonorrhoeae standard strain, as well as from 26 genital secretion samples of gonorrhea patients, were isolated and used for loop-mediated isothermal amplification (LAMP) assay, which was conducted using either an automatic real-time PCR analyzer or a water bath. The amplified porA pseudogene sequence was compared with the NCBI database and the LAMP results were compared with that of the traditional culture method for its sensitivity and specificity.

Results

LAMP was able to detect Neisseria DNA at a concentration as low as 1 pg/µL (1 × 103 CFU/mL cells). The LAMP assay results obtained using an automatic real-time PCR analyzer was similar to that of the water bath. Relative to traditional culture, the sensitivity and specificity of the LAMP assay were 94.7 and 85.7%, respectively.

Conclusion

LAMP was sensitive and reliable for detecting the porA gene of N. gonorrhoeae. It could be used as a rapid, low cost, and effective method for detecting N. gonorrhoeae.

Keywords

  • Gonorrhea
  • LAMP
  • Neisseria gonorrhoeae detection
  • porA gene

Introduction

Gonorrhea is a sexually transmitted disease caused by the bacterium Neisseria gonorrhoeae, a gram negative, obligate human pathogen. There are about 106 million incidences of gonorrheal infection each year worldwide (Organization 2012), and infection rates are about 10–20 times higher in developing countries than in developed countries (Van Der Pol et al. 2013).

Gonorrhea has been traditionally diagnosed by gram stain and culture, but testing methods based on polymerase chain reactions (PCRs) are becoming more common (Ng and Martin 2005; Barry and Klausner 2009; Deguchi et al. 2010). Traditional culture requires a specific growth media and is time-consuming, while PCR methods require specialized equipment that may not be readily available, especially in the hospitals of many developing countries.

Loop-mediated isothermal amplification (LAMP), a modified PCR technique, was first proposed in the year 2000 (Notomi et al. 2000). It uses Bst DNA polymerase, and 3-to-4 pairs of primers that are specific for 6 unique sequences of a target DNA template. The sensitivity and specificity of LAMP is similar to that of regular PCR, but LAMP requires only a water bath for the (Sirichaisinthop et al. 2011). Amplification of 1 × 1010 copies of original DNA template can be accomplished in a 65 °C water bath in 15–60 min. The product can be detected easily using various methods (Zhao et al. 2011; Li et al. 2014).

The success of PCR relies heavily on the target gene and its corresponding primers. Several target genes have been used for PCR involving N. gonorrhoeae, including 16S rRNA, cystine DNA methyltransferase, the cryptic plasmid (ccpB gene), opa, and porA pseudogene (Hjelmevoll et al. 2006). The porA pseudogene is conserved and highly specific to various strains of Neisseria gonorrhoeae (Whiley et al. 2006a, b). While the sensitivity of detection can be low because there is only a single copy in the genome (Mangold et al. 2007; Maze et al. 2011), this problem can be overcome by increasing the number of PCR cycles.

Due to its relative simplicity and low cost, LAMP has become a useful and popular method of diagnosis for many infectious diseases, especially in many developing countries (Macarthur 2009; Hopkins et al. 2013; Oriero et al. 2015). The aim of the present study is to test whether LAMP can be used as a possible method for rapid detection of N. gonorrhoeae using the porA pseudogene. Our report shows that LAMP can be used as a simple, cost-effective, and reliable method for gonorrhea diagnosis, especially in developing countries.

Methods

The study was approved by the institutional ethics committee of Third Affiliated Hospital of Guangzhou Medical University. All patients provided written consent prior to sample collection.

Clinical sample collection and other Bacterial strains

Samples were collected between March 2015 and 2016 from two hospitals in Guangzhou, southern China, namely, Third Hospital of Guangzhou Medical University, and Guangdong Institute of Dermatology.

Two genital secretion samples were collected from each patient using sterile swabs. One sample was used for traditional culture and the other for DNA isolation. Thayer-Martin (TM) agar plates (Beiruite Bio-technology, Zhengzhou, China) were used for traditional culture. Bacteria were grown on TM plates for 48 h at 36 °C in a growth chamber containing 5% CO2. The colony morphology and bacterial cells were examined using gram staining and microscopy (Ng and Martin 2005). Bacterial DNA was isolated, using a DNA isolation kit (Guangzhou Deaou Biotechnology) in accordance with the manufacture’s instructions. Isolated DNA was stored in Eppendorf tubes at −20 °C. Other bacterial strains used in this study are listed in Table 1.
Table 1

Bacterial strains used in this study

Neisseria gonorrhoeae ATCC49926

Pseudomonas aeruginosa

Candida albicans

Candida glabrata

Enterobacter cloacae

Staphylococcus epidermidis

Acinetobacter baumannii

Viridans streptococci

Staphyloccocus aureus

Klebsiella pneumoniae

Streptococcus pneumoniae

Mycobacterium tuberculosis

Candida guilliermondii

Candida parapsilosis

Neisseria cinerea

Escherichia coli

Proteus mirabilis

Proteus penneri

Enterococcus faecalis

Enterococcus faecium

Candida lipolytica

Candida krusei

Candida norvegensis

The source of all bacterial strains was: Third Affiliated Hospital of Guangzhou Medical University

LAMP and color reaction

The sequence of the N. gonorrhoeae porA gene was obtained from GenBank. Primers (Table 2) were designed using Primer Explorer version 4 online software (http://primerexplorer.jp/e). The primers were synthesized by Invitrogen.
Table 2

Primers for the Neisseria gonorrhoeae porA gene

 

Sequence (5′–3′)

F3

CCATTGATCCTTGGGACAG

B3

CAGACCGGCATAATACACAT

FIP(F1c + F2)

GGGAATCGTAACGCACGGAAATAATGTGGCTTCGCAATTG

BIP(B1c + B2)

AGCGGCAGCATTCAATTTGTTCCTGATTACTTTCCAGCGTGA

FLP

ATACCGTCGTGGCGTTTG

BLP

CGCCTATACGCCTGCTAC

The LAMP mix without DNA templates (Table 3) was first prepared on ice. Two microliters of DNA template was added to 23 µL of LAMP mix, to a total volume of 25 µL. One set of the final mix was amplified using an automatic real-time PCR analyzer (Cobas Z 480, Roche Molecular Diagnostics). The reaction condition was 45–60 min at 63 °C.
Table 3

Composition of the LAMP reaction mix

 

Components

Volume

Reaction mix

20 mM Tris–HCl (pH 8.8)

12.5 µL

10 mM KCl

 

8 mM MgSO4

 

10 mM (NH4)2SO4

 

0.1% Tween-20

 

1 mM Betaine

 

1.6 mM dNTP

 

Primer mix

FIP (1.6 µM) and BIP (1.6 µM)

1 µL

F3 (0.2 µM) and B3 (0.2 µM)

 

FLF (0.8 μM) and FLB (0.8 μM)

 

Nuclease-free water

 

8 µL

Bst DNA polymerase

 

1 µL

SYTO-9

 

0.5 µL

DNA template

 

2 µL

Total volume

 

25 µL

Reaction condition: 63 °C, 45–60 min

Another set of the final mix was amplified using a water bath, and the fluorescence signal was detected directly by the naked eye. The reaction conditions were: 63 °C-water bath for 60 min, then 80 °C-water bath for 2 min to terminate the reaction. One microliter of SYTO-9 (Guangzhou Deaou Biotechnology) was added to the tubes. The reaction was considered positive if green florescence was observed.

LAMP sensitivity test

DNA isolated from the Neisseria gonorrhoeae standard strain American Type Culture Collection (ATCC) 49926 was used to test the sensitivity of LAMP towards the porA gene. The DNA concentration of ATCC 49926 was measured and adjusted to 10 ng/µL using a spectrophotometer (Thermo NanoDrop 2000). The DNA was then diluted serially using sterile double-distilled water (ddH2O) to the following concentrations: 1 ng/µL; 100, 10, and 1 pg/µL; and 100 and 10 fg/µL. These concentrations correspond to the bacterial concentrations 1 × 106, 1 × 105, 1 × 104, 1 × 103, 1 × 102, and 1 × 101 CFU/mL, respectively.

The LAMP experiment was conducted as described above. Sterile ddH2O was used as the negative control and the 10 ng/µL DNA as a positive control. The lowest detectable concentration was determined. The LAMP experiment was then repeated using 20 different DNA templates isolated from the same N. gonorrhoeae standard strain (ATCC 49926), but each from a different colony, to further test for sensitivity and replicability (as described above). DNA isolated from 23 bacterial strains (Table 1) was also used to test the specificity of LAMP.

LAMP test of clinical samples

Isolated DNA samples from 26 patients were used for porA-LAMP experiments, which were conducted using the automatic real-time PCR analyzer as well as a water bath. The results were then compared with that of the traditional culture method.

Results

Identification of N. gonorrhoeae by the traditional method

Samples of genital secretions were tested by the traditional method. The TM agar plate cultures showed that 19 samples (73.1%) tested positive for Neisseria gonorrhoeae and 7 were negative. After a 48-h culture, N. gonorrhoeae colonies were grayish-white-to-colorless mucoid. Gram staining showed that the bacterial cells were gram negative.

Reliability and sensitivity of LAMP for amplification of N. gonorrhoeae porA pseudogene

Using DNA isolated from the N. gonorrhoeae standard strain ATCC 49926, we first tested the reliability and sensitivity of LAMP for porA amplification (Fig. 1). Amplification was detected 10 min after the reaction and reached its peak at around 20 min. No amplification was detected in the negative control (ddH2O). This indicates that LAMP is reliable for porA amplification. In addition, we found that the porA primers were specific to N. gonorrhoeae. No fluorescence (LAMP product) was detected when DNA from the 23 bacterial species (Table 1) was used as a template (Table 1; Fig. 2).
Figure 1
Fig. 1

LAMP detection of the ATCC 49926 porA gene using an automatic PCR cycler

Figure 2
Fig. 2

Specificity of LAMP for porA detection. The LAMP product (fluorescence) was detected from DNA of the Neisseria gonorrhoeae standard strain, but not in any of the 23 non-Neisseria bacteria

To test the sensitivity of the LAMP reaction, 10-fold serial dilutions of the DNA template (i.e., from 1 ng/µL to 10 fg/µL) were used for the LAMP experiment (Fig. 3). Amplification was detected 18 min after the reaction, when the initial DNA template was as low as 1 pg/µL.
Figure 3
Fig. 3

Sensitivity test for LAMP using different concentrations of DNA templates from Neisseria gonorrhoeae ATCC 49926

To further confirm the reliability of LAMP, the experiment was repeated using 20 different DNA templates isolated from the same N. gonorrhoeae standard strain (ATCC 49926), but each from a different colony, at a concentration of 1 pg/µL. Amplification products were detected from all 20 samples (Fig. 4), further indicating that LAMP is very sensitive in detecting the porA gene. No product was detected when the DNA template was replaced with ddH2O.
Figure 4
Fig. 4

LAMP assay using 20 different DNA templates isolated from the same Neisseria gonorrhoeae standard strain (ATCC 49926), but from different colonies, at a concentration of 1 pg/µL

LAMP analysis of clinical samples

LAMP was used to detect porA genes from the 26 clinical samples (Fig. 5). Nineteen (73.1%) of the clinical samples tested positive for the porA gene and 7 samples were negative. One of the 19 Neisseria-positive by traditional culture sample was LAMP-negative (false negative), and one of 7 Neisseria-negative by traditional culture sample was LAMP-positive (false positive). Compared to traditional culture, the sensitivity and specificity of the LAMP assay were 94.7 and 85.7%, respectively. The initial detection time for the positive control was shorter (16 min) than that of the clinical sample (19 min; Fig. 5), possibly because of the higher concentration of the DNA template of the positive control. A similar result was obtained using a water bath for LAMP (Fig. 6).
Figure 5
Fig. 5

A representative example of LAMP using the clinical sample and the positive control (DNA from ATCC 49926)

Figure 6
Fig. 6

LAMP assay using a water bath and direct observation of the LAMP products via fluorescence dye

Discussion

Improvements of the LAMP technique have been made constantly since its inception in 2000 (Notomi et al. 2000). The goal of this study was to develop and test a low-cost, effective method for detecting N. gonorrhoeae, especially a method that could be used in developing countries. We showed that LAMP is both reliable and sensitive for detecting the Neisseria porA gene, either by using the N. gonorrhoeae standard strain (ATCC 49926) or clinical DNA samples isolated from genital secretions of gonorrhea patients. This is consistent with a previous study, which detected the glutamine synthetase gene of N. gonorrhoeae from urine samples (Edwards et al. 2014). That study also showed that the LAMP assay was able to tolerate a urea concentration up to 1.8 M, while conventional PCR tolerates only a urea concentration no more than 100 mM. Another study showed that better detection results were obtained using an endocervical swab than urine samples (Gaydos et al. 2003).

The N. gonorrhoeae genome has been sequenced and studied extensively (Dempsey et al. 1991; Dempsey and Cannon 1994; Chung et al. 2008). Having the genome greatly facilitated diagnosis of gonorrhea, especially through molecular techniques such as PCR. Many commercial kits, such as the Aptima Combo 2 assay (Gaydos et al. 2003) and the COBAS AMPLICOR N. gonorrhoeae PCR kit (Luijt et al. 2005), have been developed with satisfactory detection rates. All these techniques require selection of the appropriate target genes (Hjelmevoll et al. 2006). In the current study, we chose the highly conserved porA pseudogene as the LAMP target gene (Whiley et al. 2006a). PorA is the only outer membrane porin gene found in the N. gonorrhoeae genome and contains a very low-level of genetic polymorphism (Unemo et al. 2005). Because of its high efficiency of amplification, porA can be detected quickly, although N. gonorrhoeae has only a single copy of porA in the genome (Hjelmevoll et al. 2006; Whiley et al. 2006b). Consistently, we found that the porA gene was detected 10 min after the reaction and reached its peak at 20 min.

Traditional culture is still used and is considered the gold standard for identifying N. gonorrhoeae infection. However, the sensitivity is low and the method is time-consuming (Caliendo et al. 2013). In addition, it is not suitable for patients who are under antibiotic treatment. In the present study, we found that the detection rates of the LAMP assay and traditional culture were similar (~70%). Using traditional culture as a standard, one false positive and one false negative were found among the 26 clinical samples (3.8%) by LAMP assay; and the sensitivity and specificity of the LAMP assay reached 94.7 and 85.7%, respectively. The high sensitivity of LAMP is more impressive when testing with the N. gonorrhoeae standard strain, detecting as low as 1 pg/µL of the DNA concentration, the equivalent of 1 × 103 CFU/mL. This sensitivity was further confirmed with 20 parallel samples of the standard strain (Fig. 4). Compared to the standard strain, the initial detection time of the clinical samples was slower (19 min compared with 16 min). This is likely caused by differences in concentration and purity, as the DNA of the standard strain was isolated directly from pure bacterial culture, and the clinical samples contained a lower bacterial load and the isolated DNA was not as pure as that of the standard strain.

The LAMP method requires much less time than traditional culture, and is also more cost-effective. In this study, we showed that the LAMP assay was accomplished in simple water baths and the reaction products could be visualized simply with the naked eye (Fig. 6). In brief, our study suggests that LAMP could be used as a simple, cost-effective, and reliable method for the diagnosis of gonorrhea, especially in developing countries. One limitation of the study is that the clinical sample size is relatively small. A larger and more diverse samples could better determine the sensitivity and reliability of the method.

Declarations

Authors’ contributions

ML, XGG and JQH carried out the molecular genetic studies, ML, and XGG participated in the sequence alignment and drafted the manuscript. ML, XZW collected clinical samples. ML1 and YX participated in the design of the study and performed the analysis. XGG conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The datasets supporting the conclusions of this article is included within the article.

Ethics approval and consent to participate

The study was approved by the institutional ethics committee of Third Affiliated Hospital of Guangzhou Medical University. All patients provided written consent prior to sample collection.

Funding

This research is financially supported by the General Research Projects of Medical and Health Sciences of Guangzhou City (Funding No: 20151A011083).

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors’ Affiliations

(1)
Department of Clinical Laboratory Medicine, The Third Affiliated Hospital of Guangzhou Medical University, Guangzhou, China
(2)
Department of Clinical Laboratory Medicine, Guangdong Center for Skin Disease & STI Control Guangzhou, Guangzhou, China
(3)
KingMed School of Laboratory Medicine, Guangzhou Medical University, Guangzhou, China

References

  1. Barry PM, Klausner JD (2009) The use of cephalosporins for gonorrhea: the impending problem of resistance. Expert Opin Pharmacother 10:555–577View ArticlePubMedPubMed CentralGoogle Scholar
  2. Caliendo AM, Gilbert DN, Ginocchio CC, Hanson KE, May L, Quinn TC, Tenover FC, Alland D, Blaschke AJ, Bonomo RA, Carroll KC, Ferraro MJ, Hirschhorn LR, Joseph WP, Karchmer T, MacIntyre AT, Reller LB, Jackson AF (2013) Infectious diseases society of a better tests, better care: improved diagnostics for infectious diseases. Clin Infect Dis. 57(Suppl 3):S139–S170View ArticlePubMedPubMed CentralGoogle Scholar
  3. Chung GT, Yoo JS, Oh HB, Lee YS, Cha SH, Kim SJ, Yoo CK (2008) Complete genome sequence of Neisseria gonorrhoeae NCCP11945. J Bacteriol 190:6035–6036View ArticlePubMedPubMed CentralGoogle Scholar
  4. Deguchi T, Nakane K, Yasuda M, Maeda S (2010) Emergence and spread of drug resistant Neisseria gonorrhoeae. J Urol. 184:851–858View ArticlePubMedGoogle Scholar
  5. Dempsey JA, Cannon JG (1994) Locations of genetic markers on the physical map of the chromosome of Neisseria gonorrhoeae FA1090. J Bacteriol 176:2055–2060View ArticlePubMedPubMed CentralGoogle Scholar
  6. Dempsey JA, Litaker W, Madhure A, Snodgrass TL, Cannon JG (1991) Physical map of the chromosome of Neisseria gonorrhoeae FA1090 with locations of genetic markers, including opa and pil genes. J Bacteriol 173:5476–5486View ArticlePubMedPubMed CentralGoogle Scholar
  7. Edwards T, Burke PA, Smalley HB, Gillies L, Hobbs G (2014) Loop-mediated isothermal amplification test for detection of Neisseria gonorrhoeae in urine samples and tolerance of the assay to the presence of urea. J Clin Microbiol 52:2163–2165View ArticlePubMedPubMed CentralGoogle Scholar
  8. Gaydos CA, Quinn TC, Willis D, Weissfeld A, Hook EW, Martin DH, Ferrero DV, Schachter J (2003) Performance of the APTIMA Combo 2 assay for detection of Chlamydia trachomatis and Neisseria gonorrhoeae in female urine and endocervical swab specimens. J Clin Microbiol 41:304–309View ArticlePubMedPubMed CentralGoogle Scholar
  9. Hjelmevoll SO, Olsen ME, Sollid JU, Haaheim H, Unemo M, Skogen V (2006) A fast real-time polymerase chain reaction method for sensitive and specific detection of the Neisseria gonorrhoeae porA pseudogene. J Mol Diagn 8:574–581View ArticlePubMedPubMed CentralGoogle Scholar
  10. Hopkins H, Gonzalez IJ, Polley SD, Angutoko P, Ategeka J, Asiimwe C, Agaba B, Kyabayinze DJ, Sutherland CJ, Perkins MD, Bell D (2013) Highly sensitive detection of malaria parasitemia in a malaria-endemic setting: performance of a new loop-mediated isothermal amplification kit in a remote clinic in Uganda. J Infect Dis 208:645–652View ArticlePubMedPubMed CentralGoogle Scholar
  11. Li D, Wang K, Chen R, Shen D (2014) Loop-mediated isothermal amplification for rapid detection of Cryptococcus neoformans. Chin J Exp Clin Infect Dis 8:80–83Google Scholar
  12. Luijt DS, Bos PA, van Zwet AA, van Voorst Vader PC, Schirm J (2005) Comparison of COBAS AMPLICOR Neisseria gonorrhoeae PCR, including confirmation with N. gonorrhoeae-specific 16S rRNA PCR, with traditional culture. J Clin Microbiol 43:1445–1447View ArticlePubMedPubMed CentralGoogle Scholar
  13. Macarthur G (2009) Global health diagnostics: research, development and regulation. Academy of Medical Sciences Workshop Report. Academy of Medical Sciences, Great Britain. ISBN 978-1-903401-20-0Google Scholar
  14. Mangold KA, Regner M, Tajuddin M, Tajuddin AM, Jennings L, Du H, Kaul KL (2007) Neisseria species identification assay for the confirmation of Neisseria gonorrhoeae-positive results of the COBAS Amplicor PCR. J Clin Microbiol 45:1403–1409View ArticlePubMedPubMed CentralGoogle Scholar
  15. Maze MJ, Young S, Creighton J, Anderson T, Werno A (2011) Nucleic acid amplification of the opa gene for detection of Neisseria gonorrhoeae: experience from a diagnostic laboratory. J Clin Microbiol 49:1128–1129View ArticlePubMedPubMed CentralGoogle Scholar
  16. Ng LK, Martin IE (2005) The laboratory diagnosis of Neisseria gonorrhoeae. Can J Infect Dis Med Microbiol 16:15–25PubMedPubMed CentralGoogle Scholar
  17. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T (2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 28:E63View ArticlePubMedPubMed CentralGoogle Scholar
  18. Oriero EC, Okebe J, Jacobs J, Van Geertruyden JP, Nwakanma D, D’Alessandro U (2015) Diagnostic performance of a novel loop-mediated isothermal amplification (LAMP) assay targeting the apicoplast genome for malaria diagnosis in a field setting in sub-Saharan Africa. Malar J 14:396View ArticlePubMedPubMed CentralGoogle Scholar
  19. Sirichaisinthop J, Buates S, Watanabe R, Han ET, Suktawonjaroenpon W, Krasaesub S, Takeo S, Tsuboi T, Sattabongkot J (2011) Evaluation of loop-mediated isothermal amplification (LAMP) for malaria diagnosis in a field setting. Am J Trop Med Hyg 85:594–596View ArticlePubMedPubMed CentralGoogle Scholar
  20. Unemo M, Norlen O, Fredlund H (2005) The porA pseudogene of Neisseria gonorrhoeae–low level of genetic polymorphism and a few, mainly identical, inactivating mutations. Apmis 113:410–419View ArticlePubMedGoogle Scholar
  21. Van Der Pol B, Taylor SN, Liesenfeld O, Williams JA, Hook EW 3rd (2013) Vaginal swabs are the optimal specimen for detection of genital Chlamydia trachomatis or Neisseria gonorrhoeae using the Cobas 4800 CT/NG test. Sex Transm Dis 40:247–250View ArticleGoogle Scholar
  22. Whiley DM, Anderson TP, Barratt K, Beaman MH, Buda PJ, Carter M, Freeman K, Hallsworth P, Limnios EA, Lum G, Merien F, Vernel-Pauillac F, Tapsall JW, Witt MJ, Nissen MD, Sloots TP (2006a) Evidence that the gonococcal porA pseudogene is present in a broad range of Neisseria gonorrhoeae strains; suitability as a diagnostic target. Pathology 38:445–448View ArticlePubMedGoogle Scholar
  23. Whiley DM, Tapsall JW, Sloots TP (2006b) Nucleic acid amplification testing for Neisseria gonorrhoeae: an ongoing challenge. J Mol Diagn 8:3–15View ArticlePubMedPubMed CentralGoogle Scholar
  24. WHO (2012) Global action plan to control the spread and impact of antimicrobial resistance in Neisseria gonorrhoeae. World Health Organization, GenevaGoogle Scholar
  25. Zhao X, Wang L, Li Y (2011) Development and application of loop-mediated isothermal amplification method on rapid detection of Pseudomonas aeruginosa strains. World J Microbial Biotechnol 27:181–184View ArticleGoogle Scholar

Copyright

© The Author(s) 2017

Advertisement