Skip to main content

Table 2 Primers for the Neisseria gonorrhoeae porA gene

From: Loop-mediated isothermal amplification of Neisseria gonorrhoeae porA pseudogene: a rapid and reliable method to detect gonorrhea

  Sequence (5′–3′)
F3 CCATTGATCCTTGGGACAG
B3 CAGACCGGCATAATACACAT
FIP(F1c + F2) GGGAATCGTAACGCACGGAAATAATGTGGCTTCGCAATTG
BIP(B1c + B2) AGCGGCAGCATTCAATTTGTTCCTGATTACTTTCCAGCGTGA
FLP ATACCGTCGTGGCGTTTG
BLP CGCCTATACGCCTGCTAC