Increase methylmercury accumulation in Arabidopsis thaliana expressing bacterial broad-spectrum mercury transporter MerE
Received: 22 July 2013
Accepted: 29 August 2013
Published: 3 September 2013
Abstract
The bacterial merE gene derived from the Tn21 mer operon encodes a broad-spectrum mercury transporter that governs the transport of methylmercury and mercuric ions across bacterial cytoplasmic membranes, and this gene is a potential molecular tool for improving the efficiency of methylmercury phytoremediation. A transgenic Arabidopsis engineered to express MerE was constructed and the impact of expression of MerE on methylmercury accumulation was evaluated. The subcellular localization of transiently expressed GFP-tagged MerE was examined in Arabidopsis suspension-cultured cells. The GFP-MerE was found to localize to the plasma membrane and cytosol. The transgenic Arabidopsis expressing MerE accumulated significantly more methymercury and mercuric ions into plants than the wild-type Arabidopsis did. The transgenic plants expressing MerE was significantly more resistant to mercuric ions, but only showed more resistant to methylmercury compared with the wild type Arabidopsis. These results demonstrated that expression of the bacterial mercury transporter MerE promoted the transport and accumulation of methylmercury in transgenic Arabidopsis, which may be a useful method for improving plants to facilitate the phytoremediation of methylmercury pollution.
Keywords
Introduction
Mercury pollution is still a worldwide problem in environments because of natural events and human activities such as coal burning, industrial use and gold-mining activities (Harada 1995). Metallic and ionic form of mercury can accumulate in sediments, where they are readily converted to highly toxic methylmercury by microbes (Barkay et al. 2003). Clinical investigations have shown that methylmercury is the principal form of mercury that accumulated in fish and biomagnifies in their consumers, causing severe neurodegenerative symptoms (Harada 1995). The severe adverse effects of this contaminant mean there is an urgent need to develop an effective and affordable technology to facilitate its removal from the environment.
Phytoremediation refers to the use of green plants in the removal of environmental pollutants, which is recognized as a cost effective, sustainable, and environmentally friendly approach that has many advantages during the large-scale clean-up of contaminated sites (Clemens et al. 2002; Kramer 2005; Malik 2004; Ruiz and Daniell 2009; Salt 1998). In recent studies, Meager et al. engineered bacterial mer operons such as MerA (mercuric reductase) to reduce reactive mercuric ions to volatile and relatively inert monoatomic Hg(0) vapor, and MerB (organomercurial lyase) to degrade methylmercury to mercuric ions into plants, thereby remediating methylmercury contamination (Meagher and Heaton 2005). Plants such as cottonwood trees (Lyyra et al. 2007) and tobacco (Heaton et al. 2003) have been modified to express either MerB or both MerB and MerA, which convert methylmercury to mercuric ions or mercury vapor, respectively. The disadvantage of this approach is that elemental mercury Hg(0) is released into the environment, where it accumulates and can eventually be converted into highly toxic methylmercury. To help address this environmental problem, a new methylmercury remediation method is required to replace the merA- mediated mercury reduction mechanism so plant cells can accumulate methylmercury from contaminated sites without releasing mercury vapor into the ambient air.
In general, rehabilitation of metal-contaminated soils by plants requires a long time for the purification process to be completed. McGrath and Zhao reported that several months were required to reduce the mercury content by half in contaminated soils (McGrath and Zhao 2003). The expression of mercury transporter in the plant may provide a means of improving mercury uptake, thereby shortening the purification completion time. In a previous study, we demonstrated for the first time that the MerE protein encoded by pE4 is localized in the membrane cell fraction and that MerE is a novel, broad-spectrum mercury transporter, which governs the transport of CH3Hg(I) and Hg(II) across bacterial cytoplasmic membranes (Kiyono et al. 2009; Sone et al. 2010).
The current study evaluated the feasibility of engineering transgenic Arabidopsis plants to express bacterial broad-spectrum mercury transporter, MerE and its potential use in the phytoremediation of methylmercury pollution. This study showed that expression of MerE promoted the transport and accumulation of methylmercury in transgenic Arabidopsis. Enhanced methylmercury accumulation mediated by MerE represents one way for improving plants to be more suitable for use in phytoremediation of methylmercury pollution.
Materials and methods
Materials and growth conditions
Strains and plasmids used in this study
Strains and plasmids | Description of relevant features(s) | Reference or source |
---|---|---|
Strains | ||
E.coli XL1-Blue | recaAI endAI gyrA96 thi hsdR17 supE44 reIAI lac/[F::Tn/0proAB + lac1q lacZM15 traD36 | (Bullock et al. 1987) |
Arabidopsis thaliana suspension-cultured cells | Alex | (Ueda et al. 2001) |
Plasmids | ||
pE4 | meR-o/p-merE in pKF19k | (Kiyono et al. 2009) |
pMAT137 | None: binary expression vector with a CaMV35S promoter produced by tandem duplication of the enhancer sequence | (Matsuoka and Nakamura 1991) |
CaMV35S(S65T)-NOS3′ | GFP in pUC18 | (Uemura et al. 2004) |
pE18 | GFP-MerE in pUC18 | This study |
pMAE2 | MerE in pMAT137 | This study |
Enzymes and reagents
The restriction enzymes, the DNA ligation kit and Taq polymerase were obtained from Takara Shuzo Corp. (Kyoto, Japan). Analytical reagent grade mercury was purchased from Wako Chemicals (Tokyo, Japan).
Plasmid construction
Oligonucleotide primers used in this study
Primer | Oligonucleotide (5′ → 3′) |
---|---|
U-Bgl-merE | GAAGATCTATGAACGCCCCTGACAAA |
L-Kpn-merE | GGGGTACCTCATGATCCGCCCCGGAA |
U-Not-merE | AAGGAAAAAAGCGGCCGCATGAACGCCCCTGACAAACT |
L-Xba-merE | GCTCTAGATCATGATCCGCCCCGGAAGG |
U-321NPTII | ATTGAACAAGATGGATTGCA |
L-1109NPTII | GAAGAACTCGTCAAGAAGGC |
β- ACT-Fd | CAACTGGGACGACATGGAGA |
β- ACT-Rv | GATCCACATCTGCTGGAAGG |
The plasmid pMAE2 that carried the merE gene was constructed in pMAT137 (Matsuoka and Nakamura 1991) as follows. The primers U-Not-merE and L-Xba-merE were used to amplify the merE region (0.23 kb) with pE18 as a template. After digestion the PCR products with Not I-Xba I, the fragment was cloned into the Not I-Xba I sites of pMAT137. The cloned fragment was sequenced and the resulting plasmid was designated as pMAE2.
Confocal laser scanning microscopy
GFP-fused proteins were transiently expressed in A. thaliana suspension-cultured cells using a published method (Uemura et al. 2004). Cells transformed with pE18 were viewed without fixation under an Olympus BX60 fluorescence microscope, which was equipped with a Model CSU10 confocal scanner (Yokogawa Electric) (Nakano 2002) and a Zeiss LSM510 META or LSM5 PASCAL microscope, which were equipped with green HeNe and argon lasers.
Transformation of plants and confirmation of transgenic plants
The pMAE2 plasmid was introduced into Agrobacterium tumefaciens (A. tumefaciens) via electroporation (Mozo and Hooykaas 1991). A. tumefaciens was grown at 25–28°C in LB medium added with 25 μg/mL kanamycin and employed for the transformation of A. thaliana. A. thaliana ecotype Columbia plants were transformed using the floral dip method (Clough and Bent 1998) by Inplanta Innovations Inc. (Kanagawa, Japan). The progeny seedlings were selected on MS medium containing 50 mg/L kanamycin. The third generations of merE transgenic plants (T3) were used for all experiments described in this paper.
Plant genomic DNA was isolated from transformed and untransformed leaves using the FTA Kit (GE Healthcare, Buckinghamshire, England) in accordance with the manufacturer’s instructions. The target genome DNA was amplified using specific primers, i.e., U-Not-merE and L-Xba-merE for merE, according to the manufacturer’s instructions (Table 2). The primers U-321NPTII and L-1109NPTII were used to amplify NOS-NPTII in each PCR reaction, as control (Table 2). The PCR products were separated on 2% agarose gels and visualized by ethidium bromide staining.
Quantitation of mRNA levels by reverse transcription PCR
Total RNA was extracted from cells using an RNeasy Plant Mini Kit (Qiagen, CA, USA), according to the manufacturer’s instructions. The Superscript First-strand Synthesis System for reverse transcription PCR (Life Technologies, CA, USA) was used to prepare single-stranded cDNA. The target cDNAs were amplified using specific primers, i.e., U-Not-merE and L-Xba-merE to merE, according to the manufacturer’s instructions. The primers β-ACT-Fd and β-ACT-Rv were used to amplify ACT1 in each PCR reaction as controls (Table 2). The PCR products were separated on 2% agarose gels and visualized by ethidium bromide staining.
Subcellular fractionation of Arabidopsis tissues
To generate roots, surface-sterilized A. thaliana seeds were germinated in sterile MS liquid medium with 100 rpm shaking using a rotary shaker in dark conditions. The roots of 14-day-old plants were homogenized in a grinding buffer, which contained 50 mM Tris–HCl, pH 7.5, 250 mM sorbitol, 5 mM EDTA, 5 mM EGTA, 1 mM dithiothreitol, and 100 μM p-(amidinophenyl) methanesulfonyl fluoride hydrochloride (APMSF). The homogenate was filtered through four layers of Miracloth (EMD Biosciences, Darmstadt, Germany), and centrifuged at 10,000 × g for 10 min. The supernatant was centrifuged at 100,000 × g for 30 min and the precipitate was then suspended in the grinding buffer.
SDS-PAGE and immunoblotting
Proteins were separated by SDS-PAGE and transferred to an Immobilon-P membrane (Millipore, Billerica, USA). After blocking with de-fatted milk, the membrane filter was incubated with rabbit anti-MerE polyclonal antibody (Kiyono et al. 2009). The membranes were washed and reacted with peroxidase-conjugated anti-rabbit IgG antibody (Sigma Aldrich, MO, USA). Anti-MerE polyclonal and peroxidase-conjugated anti-rabbit IgG antibodies were used at a dilution of 1:3,000. Chemiluminescent reagents ECL (GE Healthcare, Chalfont St Giles, UK) were used to detect antigens.
Mercury accumulation
T3 transgenic plants were cultured in MS gellan gum plates with different concentrations of HgCl2 or CH3HgCl for 2 weeks at 22°C. After treatment with 10 μM HgCl2 or 0.3 μM CH3HgCl, the total amount of mercury accumulated by an entire plant was determined as follows, using 60 plants in total. Entire plants samples were digested with a concentrated acid mixture (nitric acid: perchlonic acid = 4: 1) for 4 h at 90°C and their total cellular mercury contents were measured using an atomic absorption spectrometry analyzer HG-310 (Hiranuma, Japan). The standard deviation of the measurements was less than 10%.
Mercury resistance
The sensitivities of T3 transgenic plants to mercury were tested using the following method. The sterilized seeds from wild-type and transgenic plants were aligned in a horizontal array of MS gellan gum plates, which contained 5 μM HgCl2 or 0.3 μM CH3HgCl, where they the seeds germinated and grew vertically. The root lengths of the seedlings were measured after 2 weeks’ cultivation at 22°C.
Statistical analysis
Data analysis was performed using the statistical tools (Student’s t-test) of Microsoft Excel software.
Results
Cellular localizations of GFP-MerE in suspension-cultured plant cells
Construction of gfp-merE fusion plasmid (A) and cellular localization of GFP-MerE in suspension-cultured plant cells (B). GFP-tagged fusion proteins were expressed in suspension-cultured plant cells and viewed by confocal laser scanning microscopy. GFP fluorescence images are shown for GFP-MerE (B). Bars = 20 μm.
Expression of MerE in transgenic plants
Characterization of merE in transgenic plant lines. The structure of the DNA region transferred using the plant expression plasmids pMAE2 (A). Confirmation of the expression of merE (E2, E3, E4, E5, E6, and E7) in transgenic plants based on genomic PCR expression analysis (B). Expression analyses of merE (E2, E3, E4, E5, E6, and E7) in transgenic plants, which were determined by reverse transcription PCR (C). Transgenic plants were grown on MS gellan gum plates. Plates were incubated at 22°C for 2 weeks. Genome DNA prepared from transgenic plants and used for genomic PCR analysis of merE (U-Not-merE and L-Xba-merE) and NPT II (U-321NPTII and L-1109NPTII). The total RNA was prepared from transgenic plants and used for reverse transcription PCR analysis to determine the merE (U-Not-merE and L-Xba-merE) and Actin (primer β-ACT-Fd and β-ACT-Rv) transcription levels.
Immunoblot of MerE protein in transgenic plants. Immunoblot analysis of the crude cell extracts (lane 1), soluble fractions (lane 2), and membrane fractions (lane 3) obtained from wild type (Wild) and merE (E2) transgenic plants, which were performed using anti-MerE polyclonal antibodies. The amount of protein applied in each lane was 25 μg. The arrow indicates MerE (8 kDa).
Effect of MerE expression on mercury accumulation and mercury resistance in transgenic plants
Accumulation of mercury from MS gellan gum plates containing Hg(II) and CH 3 Hg(I). The amounts of mercury (A; ng/plant, B; ng/fresh weight) that accumulated in wild-type plants (Wild; empty bar) and merE- transgenic plants (black bar) were determined after culture for 2 weeks on MS gellan gum plates with various concentrations of HgCl2 or CH3HgCl, as described in the Materials and Methods. The data are expressed as the means ± S.E.M. based on four determinations from three independent experiments. *P < 0.05 vs. the wild type.
Susceptibility of transgenic plants to Hg(II) and CH 3 Hg(I). Sterilized seeds of wild-type (Wild) and transgenic (E2) plants were germinated and grown on MS gellan gum plates in the presence or absence of 5 μM HgCl2 and 0.3 μM CH3HgCl (A). After culture for 2 weeks at 22°C, the total wet weights of plants (B) and root growth (C) levels of wild-type plants (empty bar) and merE- transgenic plants (black bar) were evaluated as described in the Materials and Methods. The total wet weight of the wild-type plants in the absence of mercurials was considered as control (B). The data are expressed as the means ± S.E.M. based on four determinations from three independent experiments. *P < 0.05 vs. the wild type.
Discussion
Phytoremediation, using green plants to remove environmental pollutants including hazardous toxic metals removal from a large volume of contaminated sites is recognized as a cost-effective, sustainable and aesthetically pleasing technology (Tong et al. 2004). However, the use of plants, like all biological methods, does not allow 100% removal of contaminants because the remediation rates decrease as the concentrations of contaminant decrease (Clemens et al. 2002). In addition, phytoremediation is a slow process that requires a long time to complete the purification (McGrath and Zhao 2003). These potential faults may predominantly result from the low metal-uptake activity and thereby limit its usefulness for practical application.
Among the strategies being used to overcome these disadvantages is the use of metal transporter to boost the uptake and transport of metal from soil into transgenic plants (Song et al. 2003). Expression of heavy metal transporter or periplasmic Hg(II)-binding protein genes under the control of a constitutive or inducible promoter may provide a means of improving metal uptake, thereby shortening the phytoremediation completion time (Kiyono et al. 2013; Kiyono et al. 2012; Nagata et al. 2009; Hsieh et al. 2006). In the present study, a transgenic Arabidopsis plants engineered to express mercury transporter, MerE (Kiyono et al. 2009; Sone et al. 2010) was constructed and the impact of expression of MerE on methylmercury accumulation was evaluated.
By using the Agrobacterium- floral dip method, many independent transgenic Arabidopsis plants were obtained. The results obtained by genomic PCR (Figure 2B), RT-PCR (Figure 2C) and immunoblot (Figure 3) analysis demonstrated that the gfp tagged merE was successfully integrated into the genome of Arabidopsis plants and substantially transcribed into mRNA and then translated into the expected fusion proteins in the transgenic plants. Transgenic Arabidopsis plants expressing merE grew vigorously at rates similar to those of wild-type plants, without exhibiting notable symptoms of stress (Figure 5A). These results suggest that the integration of merE gene had no deleterious effects on the plant growth. The transgenic Arabidopsis expressing MerE accumulated significantly more Hg(II) and CH3Hg(I) than the wild-type Arabidopsis from the mercurial-containing medium (Figure 4). These results reveal that MerE is indeed functional as a broad-spectrum mercury transporter in transgenic Arabidopsis, and suggest that accelerated mercurials uptake into the plants mediated by MerE would provide one possible way for shortening the completion time of phytoremediation of mercury pollution.
Growth in a relatively higher concentration of mercurials and constitutive expression of mercury transport activity seem to be necessary for the plants applied in mercury remediation. The transgenic Arabidopsis displayed a relatively high level of Hg(II) and CH3Hg(I) resistance compared with the wild type (Figure 5). These results demonstrated that the toxic Hg(II) and CH3Hg(I) in the culture medium may have been transported into plant cells by the integrated merE and substantially inactivated in the cells by the physiological activity of the plant.
Phytoremediation is an effective and aesthetically pleasing technique for cleaning up soils contaminated with mercurials where excavation or bioremediation is not practical or possible (Heaton et al. 2003; Lyyra et al. 2007; Meagher and Heaton 2005). However, the technique is still in its infancy stage. This study showed that the expression of the bacterial mercury transporter MerE promoted the transport and accumulation of mercuric ions and methylmercury in transgenic Arabidopsis, which may be a useful method to facilitate the improvement of plants that could be applied to the phytoremediation of mercuric ions and methylmercury pollution. It is hoped that the efficiency of these newly-designed transgenic Arabidopsis plants will be validated in field experiments in the near future.
Declarations
Acknowledgments
We thank Miss. Y. Oka, Mr. H. Tojo, Miss. M. Kaburagi and Miss. C. Kageyama for their technical assistance. This work was supported in part by a Grant-in-Aid for Young Scientists (B) (No. 24790128) to Y.S. and a Grant-in-Aid for Scientific Research (C) (No. 24510104) to M.K. from the Ministry of Education, Science and Culture, Japan.
Authors’ Affiliations
References
- Barkay T, Miller SM, Summers AO: Bacterial mercury resistance from atoms to ecosystems. FEMS Microbiol Rev 2003,27(2–3):355–384. 10.1016/s0168-6445(03)00046-9PubMedView ArticleGoogle Scholar
- Bullock WO, Fernandez JM, Short JM: XL1-Blue: a high efficiency plasmid transforming recA Escherichia coli strain with β -galactosidase selection. BioTechniques 1987, 5: 376–379.Google Scholar
- Clemens S, Palmgren MG, Kramer U: A long way ahead: understanding and engineering plant metal accumulation. Trends Plant Sci 2002,7(7):309–315. 10.1016/S1360-1385(02)02295-1PubMedView ArticleGoogle Scholar
- Clough SJ, Bent AF: Floral dip: a simplified method for Agrobacterium -mediated transformation of Arabidopsis thaliana . Plant J 1998,16(6):735–743. 10.1046/j.1365-313x.1998.00343.xPubMedView ArticleGoogle Scholar
- Harada M: Minamata disease: methylmercury poisoning in Japan caused by environmental pollution. Crit Rev Toxicol 1995,25(1):1–24. 10.3109/10408449509089885PubMedView ArticleGoogle Scholar
- Heaton AC, Rugh CL, Kim T, Wang NJ, Meagher RB: Toward detoxifying mercury-polluted aquatic sediments with rice genetically engineered for mercury resistance. Environ Toxicol Chem 2003,22(12):2940–2947. 10.1897/02-442PubMedView ArticleGoogle Scholar
- Hsieh JL, Chen CY, Chiu MH, Chein MF, Chang JS, Endo G, Huang CC: Expressing a bacterial mercuric ion binding protein in plant for phytoremediation of heavy metals. J Hazard Mater 2006,161(2–3):920–925. 10.1016/j.jhazmat.2008.04.079Google Scholar
- Kiyono M, Sone Y, Nakamura R, Pan-Hou H, Sakabe K: The MerE protein encoded by transposon Tn 21 is a broad mercury transporter in Escherichia coli . FEBS Lett 2009,583(7):1127–1131. 10.1016/j.febslet.2009.02.039PubMedView ArticleGoogle Scholar
- Kiyono M, Oka Y, Sone Y, Tanaka M, Nakamura R, Sato MH, Pan-Hou H, Sakabe K, Inoue K: Expression of the bacterial heavy metal transporter MerC fused with a plant SNARE, SYP121, in Arabidopsis thaliana increases cadmium accumulation and tolerance. Planta 2012,235(4):841–850. 10.1007/s00425-011-1543-4PubMedView ArticleGoogle Scholar
- Kiyono M, Oka Y, Sone Y, Nakamura R, Sato MH, Sakabe K, Pan-Hou H: Bacterial heavy metal transporter MerC increases mercury accumulation in Arabidopsis thaliana . Biochem Eng J 2013, 71: 19–24. 10.1016/j.bej.2012.11.007View ArticleGoogle Scholar
- Kramer U: Phytoremediation: novel approaches to cleaning up polluted soils. Curr Opin Biotechnol 2005,16(2):133–141. 10.1016/j.copbio.2005.02.006PubMedView ArticleGoogle Scholar
- Lyyra S, Meagher RB, Kim T, Heaton A, Montello P, Balish RS, Merkle SA: Coupling two mercury resistance genes in Eastern cottonwood enhances the processing of organomercury. Plant Biotechnol J 2007,5(2):254–262. 10.1111/j.1467-7652.2006.00236.xPubMedView ArticleGoogle Scholar
- Malik A: Metal bioremediation through growing cells. Environ Int 2004,30(2):261–278. 10.1016/j.envint.2003.08.001PubMedView ArticleGoogle Scholar
- Matsuoka K, Nakamura K: Propeptide of a precursor to a plant vacuolar protein required for vacuolar targeting. Proc Natl Acad Sci USA 1991,88(3):834–838. 10.1073/pnas.88.3.834PubMed CentralPubMedView ArticleGoogle Scholar
- McGrath SP, Zhao FJ: Phytoextraction of metals and metalloids from contaminated soils. Curr Opin Biotechnol 2003,14(3):277–282. 10.1016/S0958-1669(03)00060-0PubMedView ArticleGoogle Scholar
- Meagher RB, Heaton AC: Strategies for the engineered phytoremediation of toxic element pollution: mercury and arsenic. J Ind Microbiol Biotechnol 2005,32(11–12):502–513. 10.1007/s10295-005-0255-9PubMedView ArticleGoogle Scholar
- Mozo T, Hooykaas PJ: Electroporation of megaplasmids into Agrobacterium. Plant Mol Biol 1991,16(5):917–918. 10.1007/BF00015085PubMedView ArticleGoogle Scholar
- Nagata T, Nakamura A, Akizawa T, Pan-Hou H: Genetic engineering of transgenic tobacco for enhanced uptake and bioaccumulation of mercury. Biol Pharm Bull 2009,32(9):1491–1495. 10.1248/bpb.32.1491PubMedView ArticleGoogle Scholar
- Nakano A: Spinning-disk confocal microscopy – a cutting-edge tool for imaging of membrane traffic. Cell Struct Funct 2002,27(5):349–355. 10.1247/csf.27.349PubMedView ArticleGoogle Scholar
- Ruiz ON, Daniell H: Genetic engineering to enhance mercury phytoremediation. Curr Opin Biotechnol 2009,20(2):213–219. 10.1016/j.copbio.2009.02.010PubMed CentralPubMedView ArticleGoogle Scholar
- Salt DE: Arboreal alchemy. Nat Biotechnol 1998,16(10):905. 10.1038/nbt1098-905PubMedView ArticleGoogle Scholar
- Sone Y, Pan-Hou H, Nakamura R, Sakabe K, Kiyono M: Roles played by MerE and MerT in the transport of inorganic and organic mercury compounds in Gram-negative bacteria. J Health Sci 2010,56(1):123–127. 10.1248/jhs.56.123View ArticleGoogle Scholar
- Song WY, Sohn EJ, Martinoia E, Lee YJ, Yang YY, Jasinski M, Forestier C, Hwang I, Lee Y: Engineering tolerance and accumulation of lead and cadmium in transgenic plants. Nat Biotechnol 2003,21(8):914–919. 10.1038/nbt850PubMedView ArticleGoogle Scholar
- Tong YP, Kneer R, Zhu YG: Vacuolar compartmentalization: a second-generation approach to engineering plants for phytoremediation. Trends Plant Sci 2004,9(1):7–9.PubMedView ArticleGoogle Scholar
- Ueda T, Yamaguchi M, Uchimiya H, Nakano A: Ara6, a plantunique novel type Rab GTPase, functions in the endocytic pathway of Arabidopsis thaliana . EMBO J 2001, 20: 4730–4741. 10.1093/emboj/20.17.4730PubMed CentralPubMedView ArticleGoogle Scholar
- Uemura T, Ueda T, Ohniwa RL, Nakano A, Takeyasu K, Sato MH: Systematic analysis of SNARE molecules in Arabidopsis : dissection of the post-Golgi network in plant cells. Cell Struct Funct 2004,29(2):49–65. 10.1247/csf.29.49PubMedView ArticleGoogle Scholar
Copyright
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.