Skip to main content

Table 1 Primers used for real-time qPCR analysis

From: Heat shock protein 70 (HmHsp70) from Hypsizygus marmoreus confers thermotolerance to tobacco

Primer name Sequence (5′–3′)
Q-actin-F CCTGAGGTCCTTTTCCAACCA
Q-actin-R GGATTCCGGCAGCTTCCATT
Q-18S-F GAGGGACCTGAGAAACG
Q-18S-R ATAAGACCCGAAAGAGCC
Q-hmhsp70-F GCTCACTCATTGCGCGGAATA
Q-hmhsp70-R CCGACAAGACGTTCACCATGC