Skip to main content

Advertisement

Table 1 Primers of the selected genes and internal reference gene

From: Feasibility and transcriptomic analysis of betalain production by biomembrane surface fermentation of Penicillium novae-zelandiae

Genes Forward primer Reverse primer
DDC AGCCCTCGTCATTCCCGTCTT TCGCCAACTCCGTCCTCGTAT
COMT CCACCCGTAAACCATCCACAG CAATCCAGCGAGGTCAATCAA
TYR ATCCGGTGGAGTCAACTACGA ACTGAGCAAGTGCCTGAATGT
PFK AATGATTACAGCGGCAACTCG TCGCCAACTCCGTCCTCGTAT
GOT1 TCTGAAACAGGCACGGTAATC TGAACTTTCTCGGCAAATAGG
galM GCTGACCACACCTAGCTTTGG AGGGAACCTTAGGCAGCATGT
β-tubulin GTTCTGGACGTTGCGCATCTG TGATGGCCGCTTCTGACTTCC