Skip to main content

Advertisement

Table 2 Strains, plasmids, and primers

From: Enhancing poly(3-hydroxyalkanoate) production in Escherichia coli by the removal of the regulatory gene arcA

Escherichia coli Relevant characteristics Source or reference
LSBJ fadB::Cm, ΔfadJ, atoC512 (Const), fadR601 Tappel et al. (2012a)
RSC02 ΔarcA LSBJ This study
RSC04 ΔompR LSBJ This study
RSC06 ΔarcA, ΔompR LSBJ This study
Plasmids
pKD46 λ Red recombinase expression plasmid; expresses exo, β, and γ genes from λ phage; P-araB promoter; araC; AmpR; temperature sensitive replicon Datsenko and Wanner (2000)
pKD13 Neomycin phosphotransferase flanked by FLP recombinase recognition targets, AmpR, KmR Datsenko and Wanner (2000)
pCP20 FLP recombinase expression plasmid, AmpR, temperature sensitive replicon Datsenko and Wanner ( 2000)
pBBR-C1J4SII pBBR1MCS-2 derivative ΔphaAB, phaJ4, phaC1 (STQK) Tappel et al. (2012b)
Primers a,b Sequence (5′ to 3′)
pKD13.F.arcA ATGCAGACCCCGCACATTCTTATCGTTGAAGACGAGTTGGTAACACGCAAGTGTAGGCTGGAGCTGCTTC
pKD13.R.arcA TTAATCTTCCAGATCACCGCAGAAGCGATAACCTTCACCGTGAATGGTGGATTCCGTGGATCCGTCGACC
pKD13.F.ompR ATGCAAGAGAACTACAAGATTCTGGTGGTCGATGACGACATGCGCCTGCGGTGTAGGCTGGAGCTGCTTC
pKD13.R.ompR TTAGAACATTACCTTATGACCGTACTGCTCAAGAATGCCTTTCACGCGTTATTCCGTGGATCCGTCGACC
arcA.check.F/R GTTAATTTGCAGCATGCATCAGG/GACGATGAGTTACGTATCTGG
ompR.check.F/R AAATTGTTGCGAACCTTTGG/GCAATAACGTACGGGCAAAT
qAtoA.F/R GGTGCAGCCATGTTTGATAG/CGCGAGGTTTGCTTCTTC
qAtoD.F/R ACTTGGCAACCTGACCTATC/GACCAGTTCATCTGGCTCTAC
qAtoE.F/R ACTCGGTATCGCTTACCTTG/GCAGACCCGCAATCATAAAC
qFadD.F/R TCTCCAGTCTGCATCTTTCC/CCATAGCCTTCCAGCAGATAC
qFadE.F/R TTACCCGTCTGGATGAACTG/GACGGCTTTCTTCAGCTTTC
qFadL.F/R GGGCGCTTCTATTACCTCTAA/TTTCAAGGTCGGTTGTACCC
qRpoD.F/R GAGCAAGGCTATCTGACCTATG/GCCCATGTCGTTGATCATTTG
  1. aUnderlined sequences are homologous to the gene to be deleted
  2. bForward and reverse primers are denoted with an F or R, respectively, and primers used for qPCR are denoted with a q