Skip to main content

Table 1 Sequences of primers used for qRT_PCR in this study

From: Influence of oxygen on NADH recycling and oxidative stress resistance systems in Lactobacillus panis PM1

Target gene Function Primer Tm (°C) Nucleotide sequence (5’ → 3’)
16S rRNA 16S ribosomal RNA f16S 58 tggcccaactgatatgac
r16S 58 ctctcatgcacgttcttctt
nox NADH oxidase fNOX 60 actggggctgagaagacaga
rNOX 60 tgctcatcaaaggcagtgac
npx NADH peroxidase fNPX 60 tcatcaggtgtaacgccaaa
rNPX 60 taacgcccatcttcaagtcc