AMB Express

Table 1 Amplified fragment size and full-length^a/partial sequence primers from the SL7207/pcDNA-CCOL2A1 extract determined using PCR

From: Transformed Salmonella typhimurium SL7207/pcDNA-CCOL2A1 as an orally administered DNA vaccine

Primer	Sequence (5ʹ to 3ʹ)	Size (bp)
Full-length amplified forward primer	GATCAAGCTTGTTATGGATATGCATGGACGTC	~ 4000
Full-length amplified reverse primer	GATCGAATTCTTACAAGAAGCAGACTGGGCC	~ 4000
Partial amplified forward primer	CTGGGACCCAAAGGACAGAC	1928
Partial amplified reverse primer	GTCTCGCCTCTGTCTCCTTG	1928

^a‘GATC’ at the start of a full-length amplified primer is the protective base

Back to article page