Skip to main content

Table 2 Primers used for PCR amplification and detection

From: The role of TolA, TolB, and TolR in cell morphology, OMVs production, and virulence of Salmonella Choleraesuis

Primers Sequences (5′–3′)a Function Length (bp) Restriction enzyme
tolA-A CGCAGAGCTCATTATTGAGGTTTCCGGAGTA Upstream flanking regions of tolA 301 SacI
tolA-B TCTCGGTTCCCAAAAAACTGT  
tolA-C ACAGTTTTTTGGGAACCGAGAATACTTTTCTTTATGGAAGTT Downstream flanking regions of tolA 322  
tolA-D CGGGGTACCTACCGCTATTGCGTAAATCTG KpnI
tolA-E AGGAGCGGTTGAAACAACTTG Internal regions of tolA 562  
tolA-F CTGAGATCGCCAAGCAGATCG    
tolB-A CGCAGAGCTCAATGTGTCTTGCATATTAGCCTG Upstream flanking regions of tolB 305 SacI
tolB-B CATATCTCCCATACCTGGGCCTG  
tolB-C CAGGCCCAGGTATGGGAGATATGTAATAATTAATTGATTACTAA Downstream flanking regions of tolB 269  
tolB-D CGGGGTACCACTTGTCGAGATCGAAGTAAA Kpn I
tolB-E TGCGTTATGCAGGTCATACCG Internal regions of tolB 415  
tolB-F TGACCGGAGGCGAGATCCATA    
tolR-A CGCAGAGCTCCGTTTCTTGGCACGGTAGGCT Upstream flanking regions of tolR 314 SacI
tolR-B GGCTTACCCCTTGTTGCTTTC  
tolR-C GAAAGCAACAAGGGGTAAGCCAGTCTGCGTCCCGTTGGCTTG Downstream flanking regions of tolR 320  
tolR-D CGGGGTACCGTTGCAGCTTTTTACGCTCTT KpnI
tolR-E AGGTCGTCGCGAACTTAAGTC Internal regions of tolR 351  
tolR-F AGCGCTTTAATTATTTCATCG    
  1. aBold nucleotides denote enzyme restriction sites