Skip to main content

Table 1 Primers for full-length and truncated fragments of hexon

From: Identification of a novel immunological epitope on Hexon of fowl adenovirus serotype 4

Primers Sequence of primers (5′–3′) Restriction sites
hexon-1 F CATGGATCCATGGCGGCCCTCACGC BamHI
hexon-601 F CATGGATCCATGGTGCTCGGTCGCTTC BamHI
hexon-879R CATAAGCTTTTAGAAGTTATCCCTGAACCCGAT HindIII
hexon-798R CATAAGCTTTTACGGCACGACTATGGTATCTGG HindIII
hexon-750R CATAAGCTTTTAGACGGCCACCGCTCCC HindIII
hexon-657R CATAAGCTTTTACTTGACGTAGGCACCGTAAGCG HindIII
hexon-636R CATAAGCTTTTAGTAATTGTACTGAGACTTGGC HindIII
hexon-615R CATAAGCTTTTAGAAGCGACCGAGCACG HindIII
hexon-600R CATAAGCTTTTAGCCGGTGTTGGCGTTTTG HindIII
hexon-582R CATAAGCTTTTATACCCGTCGCAGAGGATT HindIII
hexon-570R CATAAGCTTTTAAGGATTTCTTCCGGGTCC HindIII
hexon-540R CATAAGCTTTTAGGGGAAGACGCCGGAAATC HindIII
hexon-459R CATAAGCTTTTACTGACCGGAGGCGGACAC HindIII
hexon-405R CATAAGCTTTTACATGGACTCCTTGGGAGCCA HindIII
hexon-375R CATAAGCTTTTAAGCCGTGCCGCAGTAGG HindIII
hexon-312R CATAAGCTTTTAGGTCGACCCCATGTCCAGG HindIII