Skip to main content

Table 3 Primers used in this study

From: Involvement of catalase and superoxide dismutase in hydrophobic organic solvent tolerance of Escherichia coli

Primer Sequence (5′ to 3′) Positions
katE-S TACTCAGTCACTTCCCCTTC 426–445 bp upstream of the initiation codon of katE
katE-AS AACTACGGCATTATCGAGGC 934–953 bp downstream of the stop codon of katE
katG-S GGGGCAGATTAACGTTTCGT 1141–1160 bp upstream of the initiation codon of katG
katG-AS GCCAGCACAATCAGCACAAT 924–943 bp downstream of the stop codon of katG
sodA-S CGATGTTAGCGGCGACAATA 1277–1296 bp upstream of the initiation codon of sodA
sodA-AS GCTCTGGCTTTGACTTTACG 1190–1209 bp downstream of the stop codon of sodA
sodB-S TTCGATCACGCTCTGTGCTT 904–923 bp upstream of the initiation codon of sodB
sodB-AS TTAACTATCCGTTGCTGGCG 1305–1324 bp downstream of the stop codon of sodB
katEc-S AAAGTCGACATTTGCCACGCAGCATCCAG 311–330 bp upstream of the initiation codon of katE, SalI site underlined
katEc-AS TTTGGTACCAGGCCGGATAAGGCGTTCAC 69–88 bp downstream of the stop codon of katE, KpnI site underlined
katGc-S AAAGGTACCTTACGCGATTTGCCATACGC 352–371 bp upstream of the initiation codon of katG, KpnI site underlined
katGc-AS TTTGAGCTCGTGTGTAGTTTTCGTTCGCC 63–82 bp downstream of the stop codon of katG, SacI site underlined
sodAc-S AAAGCATGCTAAAAACAGGCTGCACTGGC 333–352 bp upstream of the initiation codon of sodA, SphI site underlined
sodAc-AS TTTGTCGACTTTTTTAAGCTGATATGCGGCC 32–53 bp downstream of the stop codon of sodA, SalI site underlined
sodBc-S AAAGTCGACCTCTCAGTGAAGACTACTGG 182–201 bp upstream of the initiation codon of sodB, SalI site underlined
sodBc-AS TTTGGATCCTGCCTTATCCGACCTACATC 63–82 bp downstream of the stop codon of sodB, BamHI site underlined
katEp-S AAAGAATTCAACCGGGAGGTATGTAATCC 446–466 bp upstream of the initiation codon of katE, EcoRI site underlined
katEp-AS TTTGGATCCTGCTGATGTGGGTTCTTTTCG 15–35 bp downstream of the initiation codon of katE, BamHI site underlined
katGp-S AAACCCGGGCGAATATTGCCATGGATATGG 439–459 bp upstream of the initiation codon of katG, SmaI site underlined
katGp-AS TTTGGATCCGTGGTGTTATGGATATCGTCTG 11–32 bp downstream of the initiation codon of katG, BamHI site underlined
sodAp-S AAAGAATTCGCCCAGAAATTCGGTAGTAAC 451–472 bp upstream of the initiation codon of sodA, EcoRI site underlined
sodAp-AS TTTGGATCCTCCAGGGCATCGTAAGCATACG 26–47 bp downstream of the initiation codon of sodA, BamHI site underlined
sodBp-S AAAGAATTCGTACCGGTTTTGATTGCAGC 434–453 bp upstream of the initiation codon of sodB, EcoRI site underlined
sodBp-AS TTTGGATCCGCCAGAGCATCTTTAGCATAT 27–47 bp downstream of the initiation codon of sodA, BamHI site underlined