Skip to main content

Table 1 Details of the conventional primers and the DPO primers used in this study

From: Use of dual priming oligonucleotide system-based multiplex RT-PCR assay to detect five diarrhea viruses in pig herds in South China

Virus Gene Type Sequence (5′→3′) Amplicon
TGEV N Ca Fc: GGTGGTTCTTCTACTACTTAGGTACTGGACCTCATG 472
Rd: ACATCACCTTTACCTGCAGTTCTCTTCCAGGTGTG
DPOb F: GGTGGTTCTTCTACTACTTAGGIIIIIeGACCTCATG
R: ACATCACCTTTACCTGCAGTTIIIIICCAGGTGTG
PEDV N C F: GGTGAGCGAATTGAACAACCTTCCAATTGGCATTTC 361
R: GACCCTGGTTATTTCCACGATTCTGTGAATTACCAC
DPO F: GGTGAGCGAATTGAACAACCTTCIIIIIGGCATTTC
R: GACCCTGGTTATTTCCACGATTCTIIIIITTACCAC
PRV-A VP7 C F: CTCCTTTTAATGTATGGTATTGAATATACCACAG 123
R: AAGAAATCTATAAATTATAAAGTCCATCGCACTAG
DPO F: CTCCTTTTAATGTATGGTATTIIIIITACCACAG
R: AAGAAATCTATAAATTATAAAGIIIIICGCACTAG
PDCoV N C F: TCAACGCTAGAGGAAGACCTCAGGAGCGTGGAAGTG 263
R: CATGATGCGAGGATCAGCCATACCCGTCTTCTCAG
DPO F: TCAACGCTAGAGGAAGACCTCAGIIIIITGGAAGTG
R: CATGATGCGAGGATCAGCCATAIIIIICTTCTCAG
SADS-CoV N C F: GACCTGACTGTTGTTGAGGTTACTTCTAGAAGTGC 586
R: TCCTAATTTGACTGGGTTTAGAGTAAGCCGAGACT
DPO F: GACCTGACTGTTGTTGAGGTTAIIIIIAGAAGTGC
R: TCCTAATTTGACTGGGTTTAGAIIIIICCGAGACT
  1. aC means conventional primer
  2. bDPO means dual priming oligonucleotide
  3. cF: forward primers
  4. dR: reverse primers
  5. eI means deoxyinosine