Skip to main content

Table 1 Details of primers used in the study

From: Phages from Ganges River curtail in vitro biofilms and planktonic growth of drug resistant Klebsiella pneumoniae in a zebrafish infection model

Sequence name Sequence (5′–3′) Expected product size (bp) Reference Genome Location of the expected product in genome Gene product
CL1_FP AAGGAGGGAATTACGGGATG 193 KU183006.1 Klebsiella phage vB_KpnP_IME205, complete genome 11,337–11,475 bp T4 like DNA primase/ helicae
CL1_RP AC(A/G)ATGGAGCCATTCTGGTC
CL2_FP GGAATCATGCCTGAAATGGT 125 NC_023567.2 Klebsiella phage F19, complete genome 7593–7676 bp Putative DNA primase
CL2_RP ATTACCCACTTCGGTTGCTG