Skip to main content

Table 2 Oligonucleotides used in this study

From: NADPH biosensor-based identification of an alcohol dehydrogenase variant with improved catalytic properties caused by a single charge reversal at the protein surface

Oligonucleotide Sequence (5′ → 3′) and properties
pSenSox-Lbadhfw CAATTTCACACAGGAAACAGGCGGCCGCATGTCTAACCGTTTGGATG
pSenSox-Lbadhrv CTCTCATCCGCCAAAACAGAGAATTCCTATTGAGCAGTGTAGCC
pSenSox-LbadhLibrary sequencing fw TAATCATCGGCTCGTATAATGTGTG
pSenSox-LbadhLibrary sequencing rv GCTTCTGCGTTCTGATTTAATCTG
Lbadh-mutagenesis A412G fw GATGAAGATGGTTGGACCGAACTGTTTGATGCAACC
Lbadh-mutagenesis A412G rv GGTTGCATCAAACAGTTCGGTCCAACCATCTTCATC
pASK-IBA5plus-LbadhK71E sequencing fw GAAATAATTTTGTTTAACTTTAAGAAGG
pASK-IBA5plus-LbadhK71E sequencing rv CCATTTTTCACTTCACAGGTCAAGC
  1. Overlapping regions required for Gibson assembly in oligonucleotides used for cloning of the LbadhLibrary genes into pSenSox cut with EcoRI and HindIII are shown in bold