Skip to main content

Table 1 Primer sequences of Bax, Caspase-3, and GAPDH

From: HPLC phenolic profile and induction of apoptosis by Linum usitatissimum extract in LNCaP cells by caspase3 and Bax pathways

Gene Sequence Primer sequence Annealing Product size (bp)
Bax F
R
TTCCGAGTGGCAGCTGAGATGTTT
TGCTGGCAAAGTAGAAGAGGGCAA
54 °C × 30 s 108
Caspase-3 F
R
ACTGGACTGTGGCATTGAGA
GCACAAAGCGACTGGATGAA
54 °C × 30 s 70
GAPDH F
R
ATCTGACATGCTGCCTGGAG
AAGGTTGGAAGATGGGAGTTGC
60 °C × 25 s 88