Skip to main content

Table 1 Primers used in amplifying variable region sequences of mAb 1G8

From: Generation of a recombinant chickenized monoclonal antibody against the neuraminidase of H9N2 avian influenza virus

Primer name Sequencea
VLF1 ATGGATTTTCAAGTGCAGATTTTCAG
VLF2 ATGKCCCCWRCTCAGYTYCTKGT
VLF3 ATGAAGTTGCCTGTTAGGCTGTTG
VLR ACACTCATTCCTGTTGAAGCTCTTGAC
VHF1 CAGGTGCAGCTKMAGGAGTCA
VHF2 CAGGTCCARCTGCAGCAGYCT
VHF3 GARGTGAAGCTGGTGGARTCT
VHF4 GAGGTTCAGCTTCAGCAGTCT
VHR ACAATCCCTGGGCACAATTTTC
  1. a In primers, K = G or T, W = A or T, R = A or G, Y = C or T, and M = A or C