Skip to main content

Table 3 Oligonucleotide primers designed for development of species-specific PCR and Duplex-qPCR assays.

From: Simultaneous detection of downy mildew and powdery mildew pathogens on Cucumis sativus and other cucurbits using duplex-qPCR and HRM analysis

Pathogen Primers Sequence (5ʹ– 3ʹ) Length Product size Annealing temp. ( °C) Melting curve peak ( °C)
P. cubensis PcK F GCTGGTTGATTACTGCTTGGCG 22 705 bp 58 88.05
PcK R CCGAAGCCACACAACACATAG 21
P. xanthii PxK F CCCGTGTGAACTCTTATCTG 20 290 bp 85.83
PxK R GAGGGGTGTTCTGACGCTCG 20