Skip to main content

Table 1 Primer sequences and PCR cycling conditions applied for the detection of virulence genes of E. coli, S. aureus and P. multocida strains isolated from examined calves

From: Prevalence, the antibiogram and the frequency of virulence genes of the most predominant bacterial pathogens incriminated in calf pneumonia

Bacterial SpeciesTarget genePrimer sequence (5′-3′)Size (bp)PCR cycling conditions (°C/s) for 35 cyclesReferences
DAE
E. colifimHTGCAGAACGGATAAGCCGTGG
GCAGTCACCTGCCCTCCGGTA
50894/3050/4072/40Ghanbarpour and Salehi (2010)
eaeAATGCTTAGTGCTGGTTTAGG
GCCTTCATCATTTCGCTTTC
24894/3051/3072/30Bisi-Johnson et al. (2011)
hlyAACAAGGATAAGCACTGTTCTGGCT
ACCATATAAGCGGTCATTCCCGTCA
117794/3060/5072/60Piva et al. (2003)
stx1ACACTGGATGATCTCAGTGG
CTGAATCCCCCTCCATTATG
61494/3058/4572/45Dipineto et al. (2006)
stx2CCATGACAACGGACAGCAGTT
CCTGTCAACTGAGCAGCACTTTG
779
S. aureusspaTCA ACA AAG AAC AAC AAA ATG C
GCT TTC GGT GCT TGA GAT TC
22694/305/3072/30Wada et al. (2010)
coaATAGAGATGCTGGTA CAGG
GCT TCC GAT TGT TCG ATG C
430 570 63094/3055/4072/45Iyerand Kumosani (2011)
P. multocidatoxACTTAGATGAGCGACAAGG
GAATGCCACACCTCTATAG
86494/3048/4572/45Tang et al. (2009)
  1. D denaturation, A annealing, E extension