Skip to main content

Table 2 Primers used in this study

From: Development of loop-mediated isothermal amplification coupled with nanoparticle-based lateral flow biosensor assay for Mycoplasma pneumoniae detection

AssayPrimersSequence (5′–3′)Gene
 F3GAGCGCTTTAACCAGAAGTTP1
 B3AGGCGCGGTTATATCATCC
 FIP*5′-FITC-TGGAGAAACGGGAAAGCGTGGAACGGTAGCTCCTACCCAA-3′
LAMP-LFBBIPGGTGCTCGACCAGGTGTTGG-CGGTGGTTATTGCCATACC
 LF*5′-Biotin-GAGAAGTGGGATCAGTTTGT-3′
 LBTGGATTGGGAATGGGTACA
  1. FITC, fluorescein isothiocyanate; FIP*, 5′-labeled with FITC; LF*, 5′-labeled with biotin