Skip to main content

Table 1 Oligonucleotide primers sequences encoding for amplification of virulence genes and QACs resistance genes

From: The occurrence of the multidrug resistance (MDR) and the prevalence of virulence genes and QACs resistance genes in E. coli isolated from environmental and avian sources

PrimerTarget genePrimer sequence (5′–3′)Product (bp)References
iss-1IssF-ATGTTATTTTCTGCCGCTCTG266Yaguchi et al. (2007)
iss-2R-CTATTGTGAGCAATATACCC
eaeA-1 (intimin)eaeAF-ATG CTT AGT GCT GGT TTA GG248Bisi-Johnson et al. (2011)
eaeA-2R-GCC TTC ATC ATT TCG CTT TC
papC-1papCF-TGATATCACGCAGTCAGTAGC501Jin et al. (2008)
papC-2R-CCGGCCATATTCACATAA
CFAI-1cfaIF-GCTCTGACCACAATGTTGA364Ghosal et al. (2007)
CFAI-2R-TTACACCGGATGCAGAATA
QacEΔ1-1qacEΔ1F-TAA CCCTACACAAATTGGGAGATAT362Chuanchuen et al. (2007)
QacEΔ1-2R-GCC TCC GCA GCG ACT TCC ACG
QacA/B-1qacA/BF-GCAGAAAGTGCAGAGTTCG361Noguchi et al. (2005)
QacA/B-2R-CCAGTCCAATCATGCCTG
QacC/D-1qacC/DF-GCCATAAGTACTGAAGTTATTGGA195
QacC/D-2R-GACTACGGTTGTTAAGACTAAACCT