Skip to main content

Table 2 Primer sequence used for quantitative real-time PCR analyses

From: Rumen-protected methionine a feed supplement to low dietary protein: effects on microbial population, gases production and fermentation characteristics

Target bacterial species Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′) Amplicon size (bp)
Total bacteriaa ACTCCTACGGGAGGCAGCAGT ATTACCGCGGCTGCTGGC 174
F. succinogenes b GGTATGGGATGAGCTTGC GCCTGCCCCTGAACTATC 446
R. albus b CCCTAAAAGCAGTCTTAGTTCG CCTCCTTGCGGTTAGAACA 175
R. flavefaciens b TCTGGAAACGGATGGTA CCTTTAAGACAGGAGTTTACAA 295
  1. F. succinogenes, Fibrobacter succinogenes; R. albus, Ruminococcus albus; R. flavefaciens, Ruminococcus flavefaciens
  2. aSchwiertz et al. (2010)
  3. bKoike and Kobayashi (2001)