Skip to main content

Table 2 The sequence of LAMP primers designed based on the ITS gene of Cronobacter spp.

From: Probe-free label system for rapid detection of Cronobacter genus in powdered infant formula

Primer Sequence (5′–3′)
ITS-F3 AAATGCGCGGTGTGTCAG
ITS-B3 GGTTTCCCCATTCGGACAT
ITS-FIP ACCGTGTACGCTTGTTCGCTTTCTCTCAAACTCGCAGCAC
ITS-BIP GGCAGTCAGAGGCGATGCGCCGGTTATAACGGTTCA
ITS-LF AACCTCACAACCCGAAGA
ITS-LB AGCGCCGGTAAGGTGATA