Skip to main content

Table 1 Primers used in this study

From: Stepwise partially overlapping primer-based PCR for genome walking

Primer set Stepwise partially overlapping primer set (SWPOP primer set) Specific primer set (SP primer set)a
gadA locus hyg
Primary PCR CAGTCAGTCTCAGCTAGTCAGTGTC TCCATACCCTCATCTCCATTTCCAT
(− 1 to − 25)
CGGCAATTTCGATGATGCAGCTTGG
(− 1 to − 25)
CAGTCAGTCTCGTCAGTCGTGCAGT
CAGTCAGTCTCCACGTCACCAGTCA
CAGTCAGTCTAGCAGCAGTCGTCAG
Secondary PCR AACTATCACCCCACAACGTCATCTC
(− 157 to − 181)
CGGGACTGTCGGGCGTACACAAATC
(− 64 to − 88)
Tertiary PCR ACCGTTCATAGGCGAAATTGTTTGT
(− 335 to − 359)
GACCGATGGCTGTGTAGAAGTACTC
(− 112 to − 136)
  1. Four SWPOP-P primers were respectively paired with a specific primer for primary PCR; in the subsequent secondary or tertiary PCR, the SWPOP primer and a corresponding specific primer in the same row were matched. The partial identical sequences of SWPOP primers were underlined
  2. aThe bracketed numerical ranges below specific primers refer to coordinates in the known DNA sequences (a first base at the 5′-end of an outermost specific primer is defined as-1)