Skip to main content

Table 2 Primers and relevant information of reference and target genes

From: Enhanced hypocrellin production via coexpression of alpha-amylase and hemoglobin genes in Shiraia bambusicola

Gene symbol Gene name Primers (5′-3′)
amy365-1 α-amylase F: TGGATTACGCTACTTATTAC
vgb Vireoscilla hemoglobin F: ATCGTCGGTCAAGAACTT
fad FAD/FMN-containing dehydrogenase F: TGTGACCGCCATCACCTTAC
Mono Salicylate 1-monooxygenase F: TCTCGGGGAATTATGGCACG
zftf Zinc finger transcription factor F: GAACACCGTCGCAAGATTCG
omef O-methyltransferase F: GAACTACCTGAAGGCACGCT
msf Major facilitator superfamily F: TCCCGTAGCCTTGCTTTCTG
pks Polyketide synthase F: TGCTGAGGTAGCAGTCAAGC
mco Multicopper oxidase F: TATGGCGCTACGAGTGGAC
pdc Pyruvate decarboxylase F: ATTGTAACGAACTGAATGCT
ald Acetaldehyde dehydrogenase F: GTTGGCAGTGAGAATGGA
acs Acetyl-CoA synthetase F: GTTGGCTTATACGCTCAA
acc Acetyl-CoA carboxylase F: ATCTCAACTGCCGAATACA