Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers and relevant information of reference and target genes

From: Enhanced hypocrellin production via coexpression of alpha-amylase and hemoglobin genes in Shiraia bambusicola

Gene symbol Gene name Primers (5′-3′)
amy365-1 α-amylase F: TGGATTACGCTACTTATTAC
R: GTATTGCTAACGGTATTCA
vgb Vireoscilla hemoglobin F: ATCGTCGGTCAAGAACTT
R: CCCAGGCATCAAGGATAT
fad FAD/FMN-containing dehydrogenase F: TGTGACCGCCATCACCTTAC
R: TTGTCGTATGGGTGGGAAGC
Mono Salicylate 1-monooxygenase F: TCTCGGGGAATTATGGCACG
R: ACAACCGTTCTCGCATCAGT
zftf Zinc finger transcription factor F: GAACACCGTCGCAAGATTCG
R: TCATTGGCATCGCTTGGAGT
omef O-methyltransferase F: GAACTACCTGAAGGCACGCT
R: GCTCGGAAGGATACTCGCTC
msf Major facilitator superfamily F: TCCCGTAGCCTTGCTTTCTG
R: CCGGCTTCTTCTTGACGCTA
pks Polyketide synthase F: TGCTGAGGTAGCAGTCAAGC
R: TTATGCTACGGTCGTCGCTC
mco Multicopper oxidase F: TATGGCGCTACGAGTGGAC
R: ACTCCCTGGCCGATAACGTA
pdc Pyruvate decarboxylase F: ATTGTAACGAACTGAATGCT
R: GTGGTGACTATGGCTGAA
ald Acetaldehyde dehydrogenase F: GTTGGCAGTGAGAATGGA
R: CTGTTGCGTAGTTGATGATG
acs Acetyl-CoA synthetase F: GTTGGCTTATACGCTCAA
R: TTCTGGAATCATAGGTAGGT
acc Acetyl-CoA carboxylase F: ATCTCAACTGCCGAATACA
R: AGTGCCAACAATCTCCAA
18S rRNA 18S rRNA gene F: GAAAGTTAGGGGATCGAAGA
R: TAGTCGGCATAGTTTACGGT