Skip to main content

Table 1 Primers used for construction of overexpression plasmid

From: Enhanced hypocrellin production via coexpression of alpha-amylase and hemoglobin genes in Shiraia bambusicola

Primer symbol Primers (5′-3′)
VF1 GGTGGCACTAGAGAAGACTATTTTTG
VR1 GAATTCGGAAGCGGGCAGTG
hygF TTCTCTAGTGCCACCATGAAAAAGCCTGAACTCACCG
hygR CCCGCTTCCGAATTCTTCCTTTGCCCTCGGAC
VF2 GGATCCGGGGCCGGGGTTGCTC
VR2 ACGCGTTCCGGAAATCAACCTCTGG
amy365-1F CCCGGCCCCGGATCCATGTCGGCTCCTCGTCCACGAGGC
amy365-1R ATTTCCGGAACGCGTTTATTGCCATGTACTATTCACACTCGAAGCC
vgbF CCCGGCCCCGGATCCATGCTTGATCAACAAACGATCAACA
vgbR ATTTCCGGAACGCGTCTATTCGACGGCTTGGGCGT
TtrpCF ATCCACTTAACGTTACTGAAATCATC
TtrpCR CATTTTTCGACAATCCGAGTGGAGATGTGGGAG
PgpdAF GATTGTCGAAAAATGTAAAGG
PgpdAR GATGAAGTGTTTGTTGAGCTAGGGGAG
amy365-1R1 TAACGTTAAGTGGATTTATTGCCATGTACTATTCACACTCGAAGCC
vgbF1 AACAAACACTTCATCATGCTTGATCAACAAACGATCAACA