Skip to main content

Table 1 Primers used in this study

From: LsrB-based and temperature-dependent identification of bacterial AI-2 receptor

Primers Oligonucleotide sequence (5′–3′) Description Product size (bp)
LuxS-UF TTCTGATGCGCTGTTACGT The upstream sequence of luxS 845
LuxS-Overlap-UR TCGGCAGTGCCGCGTCGACGGGGTGTTCATTGTTTTCGa   
LuxS-Overlap-DF TGAACACCCCGTCGACGCGGCACTGCCGAAAGAGAAG The downstream sequence of luxS 884
LuxS-DR TGACCGACGATAACCCGA   
pkD4-Kan-F CGCGTCGACTGTAGGCTGGAGCTGCTT Kanamycin resistance cassette 1494
pkD4-Kan-R CGCGTCGACCATATGAATATCCTCCTTAGTTC   
LsrB-F CGCGGATCCATGGCAAGACACAGCATTAAAATb lsrB 1023
LsrB-R CCCAAGCTTTCAGAAATCATATTTGTCGATATTGc   
LuxS-F CGCGGATCCATGCCGTTGTTAGATAGCTTb luxS 516
LuxS-R CCCAAGCTTCTAGATGTGCAGTTCCTGCAc   
LuxS-OutF GCGATTTGTTCTTCTTTCCTGd Primers for identification of luxS deletion 2519
LuxS-OutR GATCAAGAATCGTCACAGG   
LuxS-InF GAAGTGATGCCAGAAAGAGGGe Primers for identification of luxS deletion 307
LuxS-InR CCAGAATGCTACGCGCAATAT   
  1. a, b, c SalI, BamHI and HindIII restriction sites are underlined, respectively
  2. dA 307 bp PCR product was amplified from wild-type strain BL21(DE3), and no product was amplified from mutant strain BL21ΔluxS, using primers LuxS-inF/LuxS-inR
  3. eA 2519 or 2209 bp PCR product was amplified from wild-type strain BL21(DE3), or mutant strain BL21ΔluxS without kan, respectively, using primers LuxS-OutF/LuxS-OutR