Skip to main content

Table 3 Primers used for the quantification of the specific bacterial divisions’ expression by real-time PCR

From: Preventing subclinical necrotic enteritis through Lactobacillus johnsonii BS15 by ameliorating lipid metabolism and intestinal microflora in broiler chickens

Target species Primer sequence (5 → 3) Annealing temp (°C) Product size (bp) Reference
Total bacteria F: CGGYCCAGACTCCTACGGG
R: TTACCGCGGCTGCTGGCAC
60.0 130 Guo et al. (2008)
Firmicutes F: GGAGYATGTGGTTTAATTCGAAGCA
R: AGCTGACGACAACCATGCAC
64.5 126
Bacteroidetes F: GGARCATGTGGTTTAATTCGATGAT
R: AGCTGACGACAACCATGCAG
60.0 126
Lactobacillus spp. F: AGCAGTAGGGAATCTTCCA
R: CACCGCTACACATGGAG
64.5 341 Walter et al. (2001)
Enterococcus spp. F: CCCTTATTGTTAGTTGCCATCATT
R: ACTCGTTGTACTTCCCATTGT
59.6 144 Rinttilä et al. (2004)
Streptococcus spp. F: AGAGTTTGATCCTGGCTCAG
R: GTTAGCCGTCCCTTTCTGG
56.8 485 Franks et al. (1998)
Clostridium cluster I F: ATGCAAGTCGAGCGAKG
R: TATGCGGTATTAATCTYCCTTT
60.0 120 Rinttilä et al. (2004)
Clostridium cluster IV F: GCACAAGCAGTGGAGT
R: CTTCCTCCGTTTTGTCAA
60.0 230 Matsuki et al. (2004)
Clostridium cluster XIVa F: AAATGACGGTACCTGACTAA
R: CTTTGAGTTTCATTCTTGCGAA
60.0 440 Matsuki et al. (2002)
Bifidobacterium F: TCGCGTCYGGTGTGAAAG
R: CCACATCCAGCRTCCAC
56.9 243 Rinttilä et al. (2004)
Enterobacteriaceae F: CATTGACGTTACCCGCAGAAGAAGC
R: CTCTACGAGACTCAAGCTTGC
62.5 195 Bartosch et al. (2004)