Skip to main content

Table 1 Primers used in this study

From: Metabolic engineering of Escherichia coli to high efficient synthesis phenylacetic acid from phenylalanine

Primer name Sequence (5′–3′)
FeaB-XbaI AACTCTAGATTTAAGAAGGAGATATAATGACAGAGCCGCATGTAGCAG
FeaB-NheI–BamHI ACAGGATCCGCTAGCTTAATACCGTACACACACCGACTTAGTTT
AldB-XbaI ATCTCTAGATTTAAGAAGGAGATATAATGACCAATAATCCCCCTTCAGC
AldB-SacI–BamHI TGTGAGCTCGGATCCTCAGAACAGCCCCAACGGTT
AldH-XbaI ATCTCTAGATTTAAGAAGGAGATATAATGAATTTTCATCATCTGGCTTACTG
AldH-NheI–BamHI TCAGGATCCGCTAGCTCAGGCCTCCAGGCTTATCC
ARO8-XbaI AACTCTAGATTTAAGAAGGAGATATAATGATGACTTTACCTGAATCAAAAGACTTTTC
ARO8-XhoI CCGCTCGAGCTATTTGGAAATACCAAATTCTTCGTATAA