Skip to main content

Advertisement

Table 2 Oligonucleotides

From: Cysteine degradation gene yhaM, encoding cysteine desulfidase, serves as a genetic engineering target to improve cysteine production in Escherichia coli

Primer name Sequence (5′–3′) Use
DyhaM-FW ATGTTTGATTCGACTTTAAATCCGTTATGGCAGCGTTACATCCTCGCCGTTGAAGCCTGCTTTTTTATACTAAGTTGGCA Construction of ΔyhaM
DyhaM-RV TTATCTGGCCTTGCTCGCCATAATCTCGATAATCTGCCGATCCGTTTGCTCGCTCAAGTTAGTATAAAAAAGCTGAACGA Construction of ΔyhaM
ECOydeD-F CGCGGATCCAATGGTCATAAATGGCAGCGTAGCGC Cloning of ydeD
ECOydeD-R CGCGGATCCGCAGGGCGTTGCGGAACAAAC Cloning of ydeD
ECOyhaM-F CGCGGATCCAAGATGCCTGCCGAGAAGATTAACG Cloning of yhaM
ECOyhaM-R CGCGGATCCGAGCGAGCTGGAAGCTATCG Cloning of yhaM
yhaM(Ec)RT-F CTCGATTCCGCGAAGCTAAA Real-time PCR: detection of yhaM
yhaM(Ec)RT-R CCCCCACTTACCGCTCAA Real-time PCR: detection of yhaM
yhaO(Ec)RT-F GCCATTATTACGCTGCCGTTT Real-time PCR: detection of yhaO
yhaO(Ec)RT-R CCATCGGACTTAACGTCTGGAT Real-time PCR: detection of yhaO
metC(Ec)RT-F AAGCCGCCACCAAATATCTG Real-time PCR: detection of metC
metC(Ec)RT-R ACACGGCAGTGCCAATCA Real-time PCR: detection of metC