Skip to main content

Table 2 Primers used in this study

From: Complementary function of two transketolase isoforms from Moniliella megachiliensis in relation to stress response

Primer name Sequence (5′ → 3′)
Sequence analysis and cloning primers
 MmTKL1-forward1 GTCGAGTTGCCTTTGGTG
 MmTKL1-reverse1 AGAACGAACCAAATCCAG
 MmTKL1-met-NotI-forward AAAGCGGCCGCATGCCACTCAAATCGTTTGA
 MmTKL1-stop-NotI-reverse AAAGCGGCCGCTTACGCCAACATTTCTTTGA
 MmTKL2-met-forward1 ATGGTTGGGTTGGGTTGGGGCTGCCATGCT
 MmTKL2-stop-reverse1 TTAAAGCAATTGTTTAACCTTCTTTTGAAT
 MmTKL2-forward2 TACACTCCTGTTGGGCTC
 MmTKL2-reverse2 CAGCTGCATCAACGACAC
 T7 TAATACGACTCACTATAGGG
 sp6 ATTTAGGTGACACTATAGAA
 ScTKL1-met-forward ATGACTCAATTCACTGACATTGATAAGCTA
 ScTKL1-stop-reverse TTAGAAAGCTTTTTTCAAAGGAGAAATTAG
Gene expression analysis primers
 GAPDH-RT-forward CAAGGGTGGTGCCAAGAAGGT
 GAPDH-RT-reverse CCTTGGGGTCGTACGATTCG
 MmTKL1-RT-forward ACCTGGAAGGATCGACAGG
 MmTKL1-RT-reverse CGGTAAGTACCTTCGGGT
 MmTKL2-RT-forward CCTACTCGTCTGTACTTCCC
 MmTKL2-RT-reverse CCGAGTCAGATCCTTCCT