Skip to main content

Table 1 Primers used in this study

From: Transformation of the endochitinase gene Chi67-1 in Clonostachys rosea 67-1 increases its biocontrol activity against Sclerotinia sclerotiorum

Primer Sequence (5′–3′) Purpose
ChiF GTTGTGGTTTGCCTGGTG Real-time PCR
ChiR CCGATACTCTGCTGCTCAT
hphF ATGCCTGAACTCACCGCGACGTCTG Hygromycin amplification
hphR CTATTCCTTTGCCCTCGGACGAGTG
CF TTCAGAGTAGGCTTTTGGATTGGT Chi67-1 amplification
CR ACCCCATATTTGCTCATAATCACA
qdzF ACTCGACCTGCAGGCATGCAAGCTTGAATTCCCTTGTATCTCTACACA gpdA amplification
qdzR ACCAATCCAAAAGCCTACTCTGAAGGGAAAAGAAAGAGAAAAGAAAAG
zzzF TGTGATTATGAGCAAATATGGGGTGGATCCACTTAACGTTACTGAAA trpC amplification
zzzR GTAAACGACGGCCAGTGCCAAGCTTTCGAGTGGAGATGTGGAGTGG