Skip to main content

Table 2 Sequences of the primers used in this study

From: Biosynthesis of polyhydroxyalkanoates containing hydroxyl group from glycolate in Escherichia coli

Primer Sequence (5′–3′) Restriction sitea
bktB-FwEcoRI CCGGAATTCAAGGAGGAATAAATGACGCGTGAAGTGGTAGTGG EcoRI
bktB-RvXbaI TGCTCTAGAGCTCAGATACGCTCGAAGATGGCG XbaI
pct-FwBamHI CGCGGATCCAATGCGCAAGGTGGAGATTATC BamHI
pct-RvEcoRI CCGGAATTCTCACTTCTTCAGGCCCATCGG EcoRI
  1. aIndicated by underlining in the primer sequence