Skip to main content

Table 1 List of primers

From: Improvement and efficient display of Bacillus thuringiensis toxins on M13 phages and ribosomes

Primer Sequence (5′→3′) Restriction site
SP1 AGAGCATGCGTAGGAGAAAATAAAATGAAAAAGATTTGGCTGGCGCTGGCTGG
SP2 TCTTTGTAGTCCGCCGATGCGCTAAACGCTAAAACTAAACCAGCCAGCGCCAGCC
SP3 CCCCAAGCTTGGGAGAGCATGCGTAGGAG Hind III
SP4 (GA)10 GGCCGGCTGGGCCCCTTTGTAGTCCGCCG Sfi I
SupASC GGAACCGCGTGCCGCACAGACTGTTGAAAGTTG
FFTcM13 (GA)10 GGCCCAGCCGGCCGGAGAAAGAATAGAAACTGG Sfi I
RFTcM13 ATAGTTTAGCGGCCGCTGGAATAAATTCAAATCTGTC Not I
FDIIc TCACGGATCCAGAGAAATTTATACAAACCCAGTATTAGAAAAT Bam HI
RDIIc TATAAAGCTTACTACGATGTATCCAAGAGAACATAGGAGCTCTTATTATACT Hind III
3Aup (GA)10 GGCCCAGCCGGCCAAAGATGTCATTCAAAAAGGC Sfi I
3Alow (GA)10 GCGGCCGCATTCACTGGAATAAATTCAATTTTGTC Not I
Pro-Sf1 (GA)10 GGCCCAGCCGGCCATGGAAAATTTAAATCATTGTCC Sfi I
Pro-Not ATAGTTTAGCGGCCGCGAGGGTTCCATTAATAGCGC Not I
T7B ATACGAAATTAATACGACTCACTATAGGGAGACCACAACGG
SDMRGS AGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATATCCATGAGAGGATCG
TolAkurtz CCGCACACCAGTAAGGTGTGCGGTTTCAGTTGCCGCTTTCTTTCT
FFTc TCACGGATCCGGAGAAAGAATAGAAACTGG Bam HI
RFTc TATAAAGCTTTGGAATAAATTCAAATCTGTC Hind III
CytFRD CACGGATCCCCAAATGAAATCAATAATCTTC Bam HI
CytRRD ATAAAGCTTTGGTTGTGCAAATTTCAAAGATTG Hind III
  1. Sequences of the restriction sites are underlined