Skip to main content

Table 2 List of primers used for ESBL-encoding gene detection and pyrosequencing in Enterobacteriaceae

From: A qPCR and multiplex pyrosequencing assay combined with automated data processing for rapid and unambiguous detection of ESBL-producers Enterobacteriaceae

Target gene Primer name Sequence 5′–3′ qPCR Pyrosequencing assay Reference
blaTEM TEM-Forward biotin-CGCCGCATACACTATTCTCA Simplex Triplex Own primer design
TEM-Reverse ATACGGGAGGGCTTACCATC
TEM-seq104 TGCTTTTCTGTGACTGGTG
TEM-seq164 TTCAGCTCCGGTTCC
TEM-seq238 CGCKAGAHCCACGCT
blaSHV SHV-Forward biotin-TCTGYGCCGCCGTCATTA Simplex Duplex Own primer design
SHV-Reverse CTTTGTTATTCGGGCCAAGCA
SVH-seq179 GCTGGCCGGGGATGTG
SVH-seq238 ATSCCGCGCSCACCCC
blaCTX-M CTX-1Forward ATGTGCAGYACCAGTAARGTGA Duplex Naas et al. (2007)
CTX-1Reverse TGRGMAATCARYTTRTTCAT
CTX-2Forward TGGTRAYRTGGMTBAARGG
CTX-2Reverse TGGGTRAARTARGTSACCAGAA
  1. Degenerate base symbols (IUPAC code): K represents G/T, Y is T/C, S is G/C, R is G/A, M is A/C, H is A/T/C and B is G/T/C.