Skip to main content

Table 1 Primers used genes in Staphylococcus epidermidis

From: Prevalence of virulence genes of biofilm producing strains of Staphylococcus epidermidis isolated from clinical samples in Iran

Gene Primer Sequence (5′–3′) Annealing temperature Size of product (bp)
16s rRNA F: CCTATAAGACTGGGATAACTTCGGG
R: CTTTGAGTTTCAACCTTGCGGTCG
58 791
Ica A F: ACAGTCGCTACGAAAAGAAA
R: GGAAATGCCATAATGACAAC
56 103
ica B F: CTGATCAAGAATTTAAATCACAAA
R: AAAGTCCCATAAGCCTGTTT
56 302
Ica C F: TAACTTTAGGCGCATATGTTTT
R: TTCCAGTTAGGCTGGTATTG
56 400
ica D Ica D F: ATGGTCAAGCCCAGACAGAG
Ica D R: CGTGTTTTCAACATTTAATGCAA
56 198
ica R F: TAATCCCGAATTTTTGTGAA
R: AACGCAATAACCTTATTTTCC
56 469