Skip to main content

Table 2 Oligonucleotide primers used in this study

From: Enhanced ethanol production and reduced glycerol formation in fps1∆ mutants of Saccharomyces cerevisiae engineered for improved redox balancing

Primer name Primer sequence (5′-3′) Restriction sites*
kanMX_FPS1_F TATTTTCGATCAGATCTCATAGTGAGAAGGCGCAATT CAGTAGTTGGCATCAGAGCAGATTGTACTGAGAG  
kanMX_R AAACTCACCGAGGCAGTTCCATAG  
kanMX_F ATGGTCAGACTAAACTGGCTGACG  
kanMX_FPS1_R CATCCATGCGATACATCATGTATAGTAGGTGACCAGGCTGAGTTC TACCGCCTTTGAGTGAGCTGATAC  
UTR1_F CGGGATCC CGAAAACAATGAAGGAGAATGACATGAATA Bam HI
UTR1_R CGGAATTC CGGTAACATTATACTGAAAACCTTGCTTGA Eco RI
GapN_F CGGGATCC CGAAAACAATGACAAAACAATACAAAAACT Bam HI
GapN_R CCATCGAT GGAGATCTTCACTTTATGTCAAAGACAACA Cla I
  1. Primer overhangs containing part of FPS1 up/down sequences are depicted in bold letters.
  2. *Restriction sites with corresponding restriction enzyme are represented in italics.
\