Skip to main content

Table 1 Primer sets and sequences used for the amplification of the partial 16S rDNA sequences by qPCR

From: Absolute Quantification of Individual Biomass Concentrations in a Methanogenic Coculture

Primer name Target Primer sequence (5’-3’) Reference
DSVsp G11 201f Desulfovibrio sp. strain G11 GACCTCTGCTTGCATGTTACC This study
DSVsp G11 471r CTGATTAGCACAGTGCGGTTT This study
Arch25f Archaea CTG GTT GAT CCT GCC AG Mariakakis et al. ([2011])
MH236r Methanospirillum hungatei JF1 CAG ACT CAT CCT GAA GCG AC Worm et al. ([2011])