Skip to main content

Table 1 PCR primers used and virulence factors (adapted from Matarante et al. 2004 )

From: Bacillus subtilis natto: a non-toxic source of poly-γ-glutamic acid that could be used as a cryoprotectant for probiotic bacteria

Target gene Primer name Primer sequence (5′-3′) Amplicon size (bp) Reference
hbl – D/A hblD-f GGAGCGGTCGTTATTGTTGT 623 (Matarante et al. 2004)
hblA-r GCCGTATCTCCATTGTTCGT
nheB nheB 1500 S CTATCAGCACTTATGGCAG 769 (Matarante et al. 2004)
nhe B 2269 A ACTCCTAGCGGTGTTCC
bceT ETF TTACATTACCAGGACGTGCTT 428 (Matarante et al. 2004)
ETR TGTTTGTGATTGTAATTCAGG
entFM EntA ATGAAAAAAGTAATTTGCAGG 1269 (Matarante et al. 2004)
EntB TTAGTATGCTTTTGTGTAACC
sph Ph1 CGTGCCGATTTAATTGGGGC 558 (Matarante et al. 2004)
Ph2 CAATGTTTTAAACATGGATGCG
piplc PC105 CGCTATCAATGGACCATGG 569 (Matarante et al. 2004)
PC106 GGACTATTCCATGCTGTACC
pfkA* pfkA-F CCATCAGCTAAACCAGCC 370 This study
pfkA-R CGCGGTGGTACGAAATTA
  1. * pfkA primer was designed using the NCBI Primer-Blast.