Skip to main content

Table 1 Primers pairs for introduction of selected mutations in pET-25b(+) expression vector

From: High level expression and facile purification of recombinant silk-elastin-like polymers in auto induction shake flask cultures

Pair #1 Reverse Eco72 I 5 GAGCAGCAGACCAGCAGCAGCGGTCGGCAGCAC GTG TTC CATATGTATATCTCCTT 3
Forward Eco72 I 5 CGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGC 3
Pair #2 Reverse Eco147 I 5 GGGGTCTTCCGGGGCGAGTTCTGGCTGGCTAGG CCT TTTGATCTCGAGTGCGG 3
  Forward Eco147 I 5 AGAACTCGCCCCGGAAGACCCCGAGGATGTCGAGCACCA 3