Skip to main content

Advertisement

Table 1 List of primers and TaqMan probes for each targeted oral species with expected amplicon sizes

From: Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide

Primers or probes a, b    Sequence (5 ➞3 ) Product size (bp) Source
 S. oralis    
    gtfR F ACCAGCAGATACGAAAGAAGCAT 235 This study
    gtfR R AGGTTCGGGCAAGCGATCTTTCT   
TaqMan probe AAGGCTGCTGTTGCTGAAGAAGT   
S. gordonii    
    gtfG F CGGATGATGCTAATCAAGTGACC 177 This study
    gtfG R GTTAGCTGTTGGATTGGTTGCC   
TaqMan probe AGAACAGTCCGCTGTTCAGAGCAA   
V. parvula    
16S rRNA F GGATAGATGAAAGGTGGCCTCT 72 This study
16S rRNA R CCAACTAGCTAATCAGACGCAAT   
LNA probe* FAM-GAAGGAGG   
F. nucleatum    
    fadA F TGCAGCAAGTTTAGTAGGTG 146 This study
    fadA R CATTGTAAACTTGTTCATTTTGT   
TaqMan probe AGCACTAGATGCTGAATACCAA   
P. intermedia    
16S rRNA F CGGTCTGTTAAGCGTGTTGTG 100 Loozen et al.
16S rRNA R CACCATGAATTCCGCATACG   
TaqMan probe TGGCGGACTTGAGTGCACGC   
  1. a) F, Forward primer; R, Reverse primer.
  2. b) All TaqMan probes correspond to: 5 FAM, 3 TAMRA.
  3. * LNA probe, Roche Diagnostics.