Skip to main content

Table 1 List of primers and TaqMan probes for each targeted oral species with expected amplicon sizes

From: Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide

Primers or probes a, b    Sequence (5 ➞3 ) Product size (bp) Source
 S. oralis    
S. gordonii    
V. parvula    
F. nucleatum    
    fadA F TGCAGCAAGTTTAGTAGGTG 146 This study
P. intermedia    
  1. a) F, Forward primer; R, Reverse primer.
  2. b) All TaqMan probes correspond to: 5 FAM, 3 TAMRA.
  3. * LNA probe, Roche Diagnostics.