Skip to main content

Table 2 Oligonucleotides used

From: Analysis and application of Bacillus subtilis sortases to anchor recombinant proteins on the cell wall

Name Sequence (5' to 3') Description
ON29 GGCCATGGATCC ATGATTCAAAAACGAAAGCGGACAG 5' end of amyQ
ON42 GGCCATGACGTC TTTCTGAACATAAATGGAGACGGAC 3' end of amyQ
ON47 GGCCATGACGTC TTGGAAGCGACAGTTGAGTACG 5' end of yhcR
ON48 GAATAAGATATC TCACGTTCTGGAGGCGCTCCT 3' end of yhcR
ON49 GGCCATGACGTC CGCATGTTTGATATTGAAGAAGC 5' end of yfkN
ON50 AGCAGCGATATC TTATGCCTGATTCGCTCTATTCTG 3' end of yfkN
ON54 GGCCATTTCGAAGACCTCTTTAGCTCCTTGGAAGC 3' end of erm
ON55 GACCTGAATGTGGAACGAGTGGAC 5' end of ywpF
ON56 GGCCATTTCGAACCGACTGTAAAAAGTACAGTCGGCA 3' end of cat
ON57 CGTCTTGATCAGGATACATCTGGC 5' end of yhcT
ON58 GAGAGCCATAAACACCAATAGCCTT 5' end of neo
ON59 GGCCATGAATTC AAAGGAGGAACTCCAGAACGTGAAAAAAGTTATTC 5' end of yhcS
ON60 CTAATACGACTCACTATAGGGAGAGGATCC CGACACCTTTTTCTAAATCA 3' end of yhcS
ON61 GGCCATGAATTC AAAGGAGGAACAACAATGCGCCGGGATCA 5' end of ywpE
ON62 CTAATACGACTCACTATAGGGAGAGGATCC TCTTCGTGCTTCACTCTTGC 3' end of ywpE
ON63 TCTACATCCAGAACAACCTCTGC 5' end of Pspac
ON64 GGCCATAGATCT ATGCGCCGGGATCAAAAAATG 5' end of ywpE
ON65 GGCCATAGATCT ATGAAAAAAGTTATTCCACTATTCATCATTGC 5' end of yhcS
ON66 GGCCATAGATCT AGAATGAAGAAAAGCCGCAGGCACT 3' end of yhcS
ON67 CCAGAGATCT CAAAGGAGGAACTCCAGAACGTGAAAAAAGTTATTC 5' end of yhcS
ON68 AGTAAAGTTATCGGAATCGACTTAG 5' end of dnaK
ON69 CTAATACGACTCACTATAGGGAGAAAAGTATGCAGGAACTGTGAT 3' end of dnaK
  1. Restriction sites used for cloning are underlined