Skip to main content

Table 2 Primers and source of sequence

From: Development of butanol-tolerant Bacillus subtilis strain GRSW2-B1 as a potential bioproduction host

Region description Primer Primer sequence (5' → 3')a Source of sequence or reference
Terminator -LacZ Z-F CTCTGATGCCGCATAGTTAA pQF50,
Laboratory stock
  Z-R ctag AGATCT(BglII)CATAATGGATTTCCTTACGC  
P43 promoter P43-F GCAG GCATGC(SphI)ACTGACAAACATCACCCTCT B. subtilis 168
chromosome
  P43-R aTgc AAGCTT(HindIII)TGGTACCGCTATCACTTTAT  
PKm promoter PKm-F gcag GCATGC(SphI)GCTATGACCATGATTACGAA pUC4K,
Laboratory stock
  PKm-R aTgc AAGCTT(HindIII)TGTATTACTGTTTATGTAAGCAGAC  
P2N promoter P2N-F GCAG GCATGC(SphI)TCACTTCGTACATAATGGAC pNCMO2,
Takara Bio Inc, Japan
  P2N-R ATGC AAGCTT(HindIII)TTCGCAGGAAAGCCATG  
P2L promoter P2L-F GCAG GCATGC(SphI)GATCAGCTTGAAATATGTACATAG B. subtilis 168
chromosome
  P2L-R ATGC AAGCTT(HindIII)TGATAAATTTATTTATTTAGGATCCGATCT  
PTet promoter PTet-F gcag GCATGC(SphI)GTTCAACAAACGGGCCATAT pHY300PLK,
Takara Bio Inc, Japan
  PTet-R aTgc AAGCTT(HindIII)AATAATGAGGGCAGACGTAG  
Pspac promoter Pspac-F GCAG GCATGC(SphI)CGCACCCTGAAGAAGATTTA pDG148,
Laboratory stock
  Pspac-R ATGC AAGCTT(HindIII)AATTGTTATCCGCTCA  
PxylA promoter Pxyl-F gcag GCATGC(SphI)ATCCACCGAACTAAGTTGGT pWH1520,
Mo Bi Tec, Germany
  Pxyl-R ATcc TCTAGA(XbaI)TTGATTTAAGTGAACAAGTTTATCCATC  
pHY300PLK ΔtetL TZ-F ATCGTTAAGGGATCAACTTTGGGAG pHY300PLK,
Takara Bio Inc, Japan
  TZ-R ATTTCACCCTCCAATAATGAGGGC  
Kmr (kan) K-F ATTGGAGGGTGAAATATGAGAATAGTGAATGGACCAA pDG148,
Laboratory stock
  K-R TGATCCCTTAACGATTCAAAATGGTATGCGTTTTGAC  
16s rRNA 63-F CAGGCCTAACACATGCAAGTC (Marchesi et al. 1998)
  1387-R GGGCGGWGTGTACAAGGC  
  1. a Additional nucleotides are shown in boldface; Recognition sequences of restriction enzymes are underlined and shown in parenthesis