Bacterial strains, plasmids and deoxyoligonucleotide primers | Relevant characteristics or sequences | References or source |
---|---|---|
E. coli | ||
SCS110 | rpsL (Strr) thr leu endA thi-l lacY galK galT ara tonA tsx dam dcm | Stratagene |
supE44Δ (lac-proAB) [F’traD36 proAB lacl q ZΔM15] | ||
Novablue | endA1 hsdR17 (rK − mK +) supE44 thi-1 gyrA96 relA1 lac recA1/F’ | Novagen |
[proAB + lac I q Z ΔM15 Tn10(tet r)] | ||
C. efficiens | ||
NBRC 100395 | Wild-type C. efficiens, YS314 | NBRC |
C. glutamicum | ||
ATCC 13032 | Wild-type C. glutamicum, biotin-auxotrophic, l-glutamate producing strain | ATCC |
ATCC 21420 | C. glutamicum, l-phenylalanine producing strain | ATCC |
F | C. glutamicum ATCC 21420 derivative harboring pCH | Okai et al. (2016) |
FVan | C. glutamicum ATCC 21420 derivative harboring pCH-vanABce | This study |
Plasmids | ||
pCH | E. coli-C. glutamicum shuttle vector with HCE promoter, Kmr | Tateno et al. (2007) |
pCH-vanABce | pCH containing CE0634-CE0635 (vanAB) from C. efficiens NBRC 100395 | This study |
Oligonucleotide primers | ||
CE0634_up300-F | tcattgaccgagtactccgttt | |
CE0635_R | tcagggcacgtcaattgtcaggtggatatt | |
BglI-CE0634_up300-F | CAACAGTTGCGCAGCCTGAATGGCtcattgaccgagtactccgttt | |
BglI-CE0635_R | ATAAATCGCATTCGCCATTCAGGCTGATCGCTATTGCCCTCCGATTATTAGGAGGGCGATtcagggcacgtcaattgtcaggtggatatt |