Skip to main content

Table 1 The primer pairs used in this study for gene expressions of ABCG2, ABCI4, ABCC7, ABCC3, ABCB4, and GAPDH

From: The role of ATP-binding cassette transporter genes expression in treatment failure cutaneous leishmaniasis

Primer name Sequence (5′-3′) Target gene
ABCI4-F TGCCGTCGTCTCGCATCTCTTTTCA ABCI4
ABCI4-R ACGGCAGCAGAGCGYAGAGAAAAGT
ABCG2-F TTCGCCGAGTTTCCCGTGCAGA ABCG2
ABCG2-R AAGCGGCTGAAAGGGCACGTCT
ABCC7-F AGGAGGGAGTGCGAAAAGGGCT ABCC7
ABCC7-R TCCTCCCTCACGCTTTTCCCGA
ABCC3-F AACATCTTTTGCTCCCCACTGCCC ABCC3
ABCC3-R TTGTAGAAAACGAGGGGTGACGGG
ABCB4-F AACCAACCTGTACGCTCCGCTGTTT ABCB4
ABCB4-R ATCCGTAAAAGCCGTGCAGAACCCA
GAPDH-F AGGACATTCTCGGCTTCACCAA GAPDH
GAPDH-R GCCCCACTCGTTGTCATACCA