Skip to main content

Table 2 Oligonucleotide sequences designed as the and reverse primers for the Mfp5-CsgA and Mfp3- GvpA genes

From: A novel recombinant chimeric bio-adhesive protein consisting of mussel foot protein 3, 5, gas vesicle protein A, and CsgA curli protein expressed in Pichia pastoris

Primer Sequence
Forward Mfp5-CsgA 3′GACTGGTTCCAATTGACAAGC5′
Reverse Mfp5-CsgA 5′GCAAATGGCATTCTGACATCC3′
Forward Mfp3-GvpA 3′GACTGGTTCCAATTGACAAGC5′
Reverse Mfp3-GvpA 5′GCAAATGGCATTCTGACATCC3 ′