Skip to main content

Table 2 Primers used for the real-time fluorescence LAMP and PCR reaction system

From: Evaluation of the real-time fluorescence loop-mediated isothermal amplification assay for the detection of Ureaplasma urealyticum

UreaseB-1 Primers Sequence (5ʹ–3ʹ) Length (bp)
F3 AGGAGATAATGATTATATGTCAGGA 25
B3 TAACGCTATCACCAGTTGTG 20
FIP(F1c + F2) CAACTTGGATAGGACGGTCACCAATTAGTACCAGGAGCAATTAACT 46
BIP(B1c + B2) ATTCCATCAGGTACTGCTATTCGTTTTCCGTTAACTAAGCCGTT 44
LOOPF TCTCTACCTTCGTTCATCACAATT 24
LOOPB TTAGTCGGAACACGTGAAGTT 21
UreaseB-2 Primers Sequence (5ʹ–3ʹ) Length (bp)
F3 AGGAGATAATGATTATATGTCAGGA 25
B3 CACCAGTTGTGATACCATATAGAT 24
FIP(F1c + F2) CAACTTGGATAGGACGGTCACCAATTAGTACCAGGAGCAATTAACT 46
BIP(B1c + B2) ATTCCATCAGGTACTGCTATTCGTTTTCCGTTAACTAAGCCGTT 44
LOOPF TCTCTACCTTCGTTCATCACAATT 24
LOOPB TTAGTCGGAACACGTGAAGTT 21
UU PCR primer Sequence (5ʹ–3ʹ) Length (bp)
UU forward CAGGATCATCAAATCAATTCAC 22
UU reverse CATAATGTTCCCCTTCGTCTA 21