Skip to main content

Table 2 PCR primers for real time PCR

From: Sodium nitrate has no detrimental effect on milk fatty acid profile and rumen bacterial population in water buffaloes

Target species Forward/reverse Primer sequences (5′– > 3′) References
Total bacteria F CGGCAACGAGCGCAACCC Denman and McSweeney 2006
R CCATTGTAGCACGTGTGTAGCC
Methanogens F TTCGGTGGATCDCARAGRGC Denman et al. 2007
R GBARGTCGWAWCCGTAGAATCC
Protozoal F GCTTTCGWTGGATGTGTATT Sylvester et al. 2004
R CTTGCCCTCYAATCGTWCT
Fungi F GAGGAAGTAAAAGTCGTAACAAGGTTTC Denman and McSweeney 2006
R CAAATTCACAAAGGGTAGGATGATT
B. proteoclasticus CprF TCCGGTGGTATGAGATGGGC Shingfield et al. 2012
CprR GTCGCTGCATCAGAGTTTCCT
CprP CCGCTTGGCCGTCCGACCTCTCAGTCCGAGCGG
B. fibrisolvens + Pseudobutyrivibrio spp. BfiF GCCTCAGCGTCAGTAATCG Shingfield et al. 2012
BfiR GGAGCGTAGGCGGTTTTAC
Atypical Butyrivibrio AtbF GACGGTGTATCAAGTCTGAAGTG Shingfield et al. 2012
AtbR GCCGGCACTGAAAGACTATGTC
B. hungatei BhuF AGGGTAATGCCTGTAGCTC Shingfield et al. 2012
BhuR TCACCCTCGCGGGAT